How to recognize single-end fastq files

Question

[ATCG]

Hi, I have fastq files which are all R1 but I want to be sure that they are single-end sequencing ( in case R2 was misplaced for example) I'm unsure if for single-end the 1 from this code 1:N:0:GGAGAA represents one of a pair?? Here is what R1 file looks like:

+
AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE<EEEEEEEEEEEEAEEE
@NS500449:529:HYW33BGX5:1:11101:12403:1046 1:N:0:GGAGAA
CGGAANTTTACGTTCGCTGTGTTTGTGTACGACACAAAGTTTGTGCCAAGTTTTTTAAATCAATTACATTTTTGA


+
AAAAA#6AEE/EEEEEEEEE6EEEEEEEEAEEAEEEEEEEA<<E/AEEAEA/EEAEE//EEEEEEEAAEEEE<E<
@NS500449:529:HYW33BGX5:1:11101:8275:1047 1:N:0:GGAGAA
CGAAGNCCTTGGTTCAAAAGGTTCTGGAGTTCGTGGATGAGCATGGAACCGAGGTGCTTAACCTGGGCAGCTTCA


+
AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEAEEEEEAE
@NS500449:529:HYW33BGX5:1:11101:19612:1048 1:N:0:GGAGAA
GCAGCNGGCAATAATCTTAATGCCCATGGAATTACTCCGGATAAAGATCTGCCAAAGTCCACGGCAATGCCCAGCA

Thanks for your time!

[GenoMax]

in case R2 was misplaced

No way to know for sure unless one knew the sample was sequenced as paired-end to begin with.

[ATCG]

So there is no way to know just by looking at the file?? That can not be right, not surprising, this information should be encoded in the file!

[GenoMax]

That information is in the file. 1:N:0:GGAGAA says this is read 1. If it is on its own, it is single-end data (without 2:N:0:GGAGAA to go with it).

Answer 1

[swbarnes2]

I'm unsure if for single-end the 1 from this code 1:N:0:GGAGAA represents one of a pair??

Nope. My single end sequencing has the same thing.