Empty .fa file after fa_some_records
0
0
Entering edit mode
3.8 years ago

Hi! im generating a .fa file with the sequences of a list of genes that i got from a RNA-seq analysis. I did it with this

library(fastaR)

genelist <- scan("genelist.txt",  what="character", sep=NULL)

fa_some_records(gene_list=genelist, fasta_file="genoma.fna", outfile="sc_myGenelist.fa")

The bad news are that after that, the file sc_myGenelist.fa is empty (if i open with gedit) and the weight its 0kb)

i think the problem is because in genelist.txt the format is for example EGR_09983 and in the genoma.fna file, the format is like this NW_020171337.1

Is that a problem?

Thank you all!

there are the first lines of the files:

genelist.txt

EGR_01804
EGR_05374
EGR_07251
EGR_10508
EGR_07266
EGR_05599
EGR_01271
EGR_11080
EGR_10767
EGR_03982

genoma.fna

>NW_020171337.1 Echinococcus granulosus chromosome Unknown EG_S00967, whole genome shotgun sequence
AAATCAAATGACTGGCAAGACTACATCACTGCTGAAGTTGCTGCATCTAGTGTGagctaaaaggcaaaaattggaaagTA
CGCATTTCTGACAGGGTCATCTATTTGCTATCCTTTAGTAGGGAACATGCACACAGGTTTTAATTGCTTTAGGGAAAATG
GTTAGATTTAGTACAGTTTCACAAAATCCACATCTCCAATAATTCATCGGTTTCCTAATGAAATTGTACCTGATGCGTAG
ATTGTAATGGTCAAAGTTTATGGGATCCTGAGTGCTACAAGTGCACCAGAAcaaaattaaaggcaaaagcaaaatgcGCT
TTATTGACTGTCAACACATGGCAATACTGTGCTGGTGTGCACCCGAATTAGGGCTTCTAGTAATACGATTGTGGGGTTCT
CTGTTACCtccaaattcaacaaaatcatTACTGGCTGCCGTTCAGTATATTAAAAGTGGACACCATTCTACattggattt
tacaaaatataaatcTATTTTATCATAATTAACGataaaaggttttatttttattccattgtTTGGTATTTGCGTCATAG
CTTGCGTTAAAGTGCAGTAGTTCAAACCAAAGTAAACATTAATACCAAATGTAGAGGGCGATATCTGACGTTCTTCcttg
attattttctttttttaaaagaaaaaccatATTGTTAGGGAGTATAAGTCTCCCATGGCAGCAAAAAAAGTGTGTCGAAC
TTGAAACTGTGCAAATGAAGagagtttgcaaaaatacacCAAGCTAAGTGTGTTTCAAGGGGGGATTAAAGATGTGGAAA
GTGTGCTTAAGTTGTGATAAATCACGTTTGCGATATTAGCGCCACAAACTCCTTTATCAAAGTGCCTCTCATCGACAATC
AAAAGTGTTCGATTTAGTTCTAAACCTTTGAAGGTCCATCGCCCGCCCATCCACCAATTTACCCACACATTCACCTCGAT
CATCTCGCTTTCTTTACTAATATTGATAAAGAGATTCCTCTAA
RNA-Seq R software error • 573 views
ADD COMMENT
1
Entering edit mode

I assume query (genelist.txt) should match exactly to the headers in multi-fasta (genoma.fna) file

ADD REPLY
0
Entering edit mode

Switch to a better documented/used - more popular - tool than a random github repository. Try seqkit, maybe.

ADD REPLY

Login before adding your answer.

Traffic: 1714 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6