Automatically change N for consensus sequence

Question

[dasilvauirajan]

I have thousands of fasta sequences, and many of them have N letters in the middle os alignment. I would like to use this sequences to test a tool, but i don't want just retire de N letters, but change it for consensus of my whole alignment. Any way to do it easily?

[dasilvauirajan]

It is nucleotide sequences by the way

[cpad0112]

can you please rephrase the question or give an example?

[dasilvauirajan]

Consense:                 TGATGTCTATTAATTACGTA
My fasta sequences:       TGATGTCTNNNNNTACGTA
                          TGNNNTCTATTAATTACGTA
                          TGATGTCTATTAATTACGTA

I want to replace the N letters with correspondent consense letter

[cpad0112]

Please define an invariable sequence with in the pattern. If every position is replaceable, it is not easy to replace the Ns.