miRDeep2 problem with reads_collapsed.fa
3
0
Entering edit mode
16 months ago
LynxLynx • 0

Hello everyone! I'm trying to run mirdeep2.pl Command I use is following: miRDeep2.pl reads_collapsed.fa Lusitatissimum_200_BGIv1.0.fa SRR8582417.arf none none none

1) reads_collapsed.fa file was created with SAM to ARF built-in mirdeep2 converter and has the following content:

>seq_1_x1
CTTATAGTGTAAGGTGGAATGAAG
>seq_2_x1
ATGTCACCGAGTCTGTTACGCAAT
>seq_3_x2
AGGGAAGAAGAACTAATATTTG
.......

2) Lusitatissimum_200_BGIv1.0.fa is my reference genome

3) SRR8582417.arf was generated with converter as well

miRDeep2 starts to run, but then it crashes with the error:

> #testing input files
> #testing input files sanity_check_reads_ready_file.pl reads_collapsed.fa
> 
> started: 23:31:07 Error: problem with reads_collapsed.fa Error in line
> 434.802: Either the sequence contains less than 17 characters or contains characters others than [acgtunACGTUN]
> 
> Please make sure that your file only comprises sequences that have at
> least 17 characters
> 
> containing letters [acgtunACGTUN]

Both statements are false actually and alll files are in the working directory What's the problem?

RNA-Seq microRNA mirdeep2 • 707 views
ADD COMMENT
0
Entering edit mode
16 months ago
Barry Digby ▴ 780

Take a look at this tutorial A: mireap procedure short tutorial

You will need to split the fasta headers so that the collapsed read counts have a space separating the ID and count using sed

>seq_1_x1
CTTATAGTGTAAGGTGGAATGAAG

to

>seq_1_x 1
CTTATAGTGTAAGGTGGAATGAAG
ADD COMMENT
0
Entering edit mode

Thank you! But there was a test file in mirdeep2/tutorial. I ran mirdeep with my files + this test file and it was ok.

>seq_0_x149538
TCACCGGGTGGAAACTAGCAGT

But this file has the same header' structure as mine. Why does it work?

ADD REPLY
0
Entering edit mode

sorry, I must have had it confused with mireap. are you sure the sequence lengths are all above 17? you might have to dig deeper into that.

awk '/^>/{if (l!="") print l; print; l=0; next}{l+=length($0)}END{print l}' test.fa > lenghts.txt

and parse output

ADD REPLY
0
Entering edit mode

I have removed all strings shorter than 18 with mapper.pl reads.fa -c -j -l 18 -m -s reads_collapsed.fa

Just to be sure I also removed all non-printable chrs using command line sed 's/[^[:print:]]//g' reads.fa > clean.fa

Did not help(

Then I just removed line 434.802, didn't help as well

ADD REPLY
0
Entering edit mode

By the way, the error is still in line 434.802 though I removed it

ADD REPLY
0
Entering edit mode
16 months ago
LynxLynx • 0

I just mapped reads again using mirdeep2 and obtained ARF file. So I didn't have to use converter :)

ADD COMMENT
0
Entering edit mode

It worked? great! So the solution was to remake the arf file?

ADD REPLY
0
Entering edit mode

Hi,

How did you solve that problem?

My error is #testing input files Error: problem with /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa perl: warning: Setting locale failed. perl: warning: Please check that your locale settings: LANGUAGE = "en_IE:en", LC_ALL = (unset), LC_CTYPE = "UTF-8", LANG = "en_IE.UTF-8" are supported and installed on your system. perl: warning: Falling back to a fallback locale ("en_IE.UTF-8").

But it didnot say what the problem is.

And my code is :miRDeep2.pl /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa /home/workspace/wangdi/cattle_miRNA/test/5_ref/bta.fa /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185.arf none none none -t Cow

In addition, when I use the bta_mature and bta_hairpin miRNA fasta file (generate from miRBase), the errer is "problem bta_mature.fa".

This really annoys me for weeks. Does anyone have idea about this?

Thanks a lot.

Di.

ADD REPLY
0
Entering edit mode
16 months ago
di.wang1 • 0

Hi,

How did you solve that problem?

My error is "#testing input files Error: problem with /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa perl: warning: Setting locale failed. perl: warning: Please check that your locale settings: LANGUAGE = "en_IE:en", LC_ALL = (unset), LC_CTYPE = "UTF-8", LANG = "en_IE.UTF-8" are supported and installed on your system. perl: warning: Falling back to a fallback locale ("en_IE.UTF-8")."

But it didnot say what the problem is.

And my code is :miRDeep2.pl /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa /home/workspace/wangdi/cattle_miRNA/test/5_ref/bta.fa /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185.arf none none none -t Cow

In addition, when I use the bta_mature and bta_hairpin miRNA fasta file (generate from miRBase), the errer is "problem bta_mature.fa".

This really annoys me for weeks. Does anyone have idea about this?

Thanks a lot.

Di.

ADD COMMENT

Login before adding your answer.

Traffic: 2302 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6