.seq extension files
0
0
Entering edit mode
2.1 years ago

I am dealing with a file called GABPA_GM12878_GABP_HudsonAlpha_AC.seq.gz which is a CLIP seq dataset, the format is as follows:

FoldID    EventID    seq    Bound
A    seq_00001_peak    AACCAAGAACACAACTGAAATGGTGCGTCCCGCTGCCAAACACGTCCCCGCCCTCTCTTCCGCTTCCGGCCTGGCGCCTTCCTCCCCCTTTGCGCTCCGGT    1
A    seq_00003_peak    GGAACCTCCGCTTCCGGCTCCACGTCCGCCCGGAAGAAGATCTGCTGCACACTTCCGTTTCCGGTCCGTGCCCTTGGGGCTCCGTGTCCTGCTGTCTTTCC    1
A    seq_00005_peak    GAGGGCGACCGGAAGTGCTCACGTCTTCACCTTCCCCGCCACGCCACCGTCCTTTCAGGCCCAGCGTGCAGCAGGAAGGAGGACTCTTTTGCCGCGGACTC    1
A    seq_00007_peak    TTACGGCGCCGGAAGCAGCGGTCCTCCCCCGTCCTTCACTTCCGGCCCCCGGTCCGTCACCGACGCCGTTCCCAGCGCCAGCGCGGTGTGGTGGATCGTGA    1
A seq_00009_peak    CCGCGCCGGAAGCCGCTGTCTTTCCCGTCCCTCGCCGGAAGTGGTCCTCTTCTTACCCATCCCTCTCAGGAAGTGGGCACAAACTCTCGCCCGACACCACG    1
A    seq_00011_peak    TTTCCCCCTCCGCTCCGCCCACTTCCGCCCAGCAGAAGGCACCGGAAGTAGAGCTGCCCCTAGTTGCGGAAGTGCCTCGCCTGGCTTGCTCAAGTCCTCTC    1
A    seq_00013_peak    CAGTGGGGCCGGAAGTTGTGTTCACTCGGGTCCACTCCGCAGAGTCCCGACGGAAGCGAAAGAAACTCGAGCGACGGGGGTTGAGTTCCGGGGGAGGTTGA    1
A    seq_00015_peak    CTCTTCCCCGAAACCGCGGTGCTCCCACTTCCTGCAGTCCGAGGTTCCGACTCGACGCCAGCTCCGCGAGCAATGGTTCCGCCCTGCGCCCTGCCCCTTCC    1
A    seq_00017_peak    CCAACAGCAGGAACCTGTACGGAAGACGGGAAGGGCCCGGTACGCGCCGTTTGCAAACCCCGCAGAAACCAGCGGCGCCACCAGAAGGTTCCGTCTGTGGA    1

I was wondering if there is more information about this format and if there is a way to convert .fasta files to .seq files Thanks!

ChIP-Seq sequence • 365 views
ADD COMMENT
1
Entering edit mode

if there is a way to convert .fasta files to .seq files

If you convert your fasta file to tab delimited text (use answers here: fasta file to tab delimited file ) then it should look similar to format above. You will need to figure out what to put in FoldID and Bound columns.

ADD REPLY
0
Entering edit mode

Thank you so much, this is exactly what I needed.

ADD REPLY

Login before adding your answer.

Traffic: 792 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6