Entering edit mode
3.8 years ago
di.wang1
•
0
Hi,
I'm using miRDeep2.pl to identify bovine know and novel miRNAs.
When I use bta_mature.fa and bta_hairpin.fa, my code is:
nohup miRDeep2.pl ~/ERR558186_collapsed.fa ~/bta_genome.fa ~/ERR558186.arf ~/bta_mature-miRNA.fa none ~/bta_hairpin-miRNA.fa -t Cow &
The error is
problem with bta_mature.fa
. my *.fa is shown as following:head bta_mature_whitespace_remove.fa >bta-miR-26a_MIMAT0003516_Bos_taurus_miR-26a UUCAAGUAAUCCAGGAUAGGCU >bta-miR-18b_MIMAT0003517_Bos_taurus_miR-18b UAAGGUGCAUCUAGUGCAGUUA >bta-miR-29a_MIMAT0003518_Bos_taurus_miR-29a CUAGCACCAUCUGAAAUCGGUUA >bta-let-7f_MIMAT0003519_Bos_taurus_let-7f UGAGGUAGUAGAUUGUAUAGUU >bta-miR-101_MIMAT0003520_Bos_taurus_miR-101 UACAGUACUGUGAUAACUGAA head bta_hairpin_whitespace_remove.fa >bta-mir-26a-2_MI0004731_Bos_taurus_miR-26a-2_stem-loop GGCUGUGGCUGGAUUCAAGUAAUCCAGGAUAGGCUGUUUCCAUCUGUGAGGCCUAUUCUU >bta-mir-18b_MI0004732_Bos_taurus_miR-18b_stem-loop CUUGUGUUAAGGUGCAUCUAGUGCAGUUAGUGAAGCAGCUCAGAAUCUACUGCCCUAAAU >bta-mir-29a_MI0004733_Bos_taurus_miR-29a_stem-loop AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGG >bta-let-7f-2_MI0004734_Bos_taurus_let-7f-2_stem-loop UGUGGGAUGAGGUAGUAGAUUGUAUAGUUUUAGGGUCAUACCCCAUCUUGGAGAUAACUA >bta-mir-101-2_MI0004735_Bos_taurus_miR-101-2_stem-loop ACUGUCCUUUUUCGGUUAUCAUGGUACCGAUGCUGUAUAUCUGAAAGGUACAGUACUGUG
when I do analysis without related miRNAs, the code is:
nohup miRDeep2.pl ~/ERR558186_collapsed.fa ~/bta_genome.fa ~/ERR558186.arf none none none -t Cow -b 4 -P &
the error is still here
problem with ~/ERR558185_collapsed.fa
.the
ERR558185_collapsed.fa
is generated using mapper.pl, and shown as following:head ERR558185_collapsed.fa >seq_0_x385900 GGCTGGTCCGATGGTAGTGGGTTACCAGAAC >seq_385900_x186326 GGCTGGTCCGAAGGTAGTGAGTTATCTCAAT >seq_572226_x180010 TGGAGTGTGACAATGGTGTTT >seq_752236_x133787 TGGAGTGTGACAATGGTGTTTG >seq_886023_x93342 CGCGACCTCAGATCAGA
The headers in all the fasta files do not have whitespaces, I don't know where the problem is.
Does anyone have idea about this error?
Thanks a lot.
Di.
Is
none
a valid command line option? I don't see that being used in any of miRdeep2 tutorials. Here is a tutorial.yes the fa files are optional, see below:
The user wishes to identify miRNAs in deep sequencing data from an animal with no related species in miRBase:
Ok. For some programs order of program options is important. So make sure the
none
option is in the correct order/spot.Please leave the formatting as is. It is difficult to read they way you are posting this data.
Please use the formatting bar (especially the
code
option) to present your post better. I had done this for you but you have chosen to revert back to the original.hi could you tell me how to add figures in?
Follow this: How to add images to a Biostars post
Instead of
nohup
, use ascreen
session. nohup interferes with writing to STDOUT/STDERR.For the moment, just skip the
nohup
and&
, run the task in the foreground and see if things work OK. If you see the same error, the problem definitely lies with the input files.Hi,
I tried to remove
nohup
and&
, but the error is still here.But I don't think there is problem with my input file.
My input file of ERR558185_collapsed.fa is shown as below:
My code is
Is that all it says? "problem with FASTA"? That is a weird error message. I think the next step is to look into the code and find why that error is happening, but developers are supposed to give more verbose error messages.
EDIT
I looked at the code and it should print more messages to STDERR before it prints the "Problem with..." message - the developers seems to have done a fine job. Please give us everything it prints to STDERR and STDOUT so we can get some context on what's going on.
Hi,
All the error reported is
Do you have any idea about it?
I have tried everything I can do, including re-install the software.
My friend used the same files and the same code in a different Linux system, the code and files run OK.
So I'm wondering - it might be some problem with the server that I use? But don't know what the exact problem is.
I would be very grateful if you could help solve the problem.
Thanks a million.
See if this helps: https://stackoverflow.com/questions/2499794/how-to-fix-a-locale-setting-warning-from-perl
Thanks! I'll have a try.