Question: mirdeep2.pl error "problem with *.fa"
0
gravatar for di.wang1
6 weeks ago by
di.wang10
di.wang10 wrote:

Hi,

I'm using miRDeep2.pl to identify bovine know and novel miRNAs.

  1. When I use bta_mature.fa and bta_hairpin.fa, my code is:

    nohup miRDeep2.pl ~/ERR558186_collapsed.fa ~/bta_genome.fa ~/ERR558186.arf ~/bta_mature-miRNA.fa none ~/bta_hairpin-miRNA.fa -t Cow &
    

    The error is problem with bta_mature.fa. my *.fa is shown as following:

    head bta_mature_whitespace_remove.fa 
    
    >bta-miR-26a_MIMAT0003516_Bos_taurus_miR-26a
    UUCAAGUAAUCCAGGAUAGGCU
    >bta-miR-18b_MIMAT0003517_Bos_taurus_miR-18b
    UAAGGUGCAUCUAGUGCAGUUA
    >bta-miR-29a_MIMAT0003518_Bos_taurus_miR-29a
    CUAGCACCAUCUGAAAUCGGUUA
    >bta-let-7f_MIMAT0003519_Bos_taurus_let-7f
    UGAGGUAGUAGAUUGUAUAGUU
    >bta-miR-101_MIMAT0003520_Bos_taurus_miR-101
    UACAGUACUGUGAUAACUGAA
    
    head bta_hairpin_whitespace_remove.fa 
    >bta-mir-26a-2_MI0004731_Bos_taurus_miR-26a-2_stem-loop
    GGCUGUGGCUGGAUUCAAGUAAUCCAGGAUAGGCUGUUUCCAUCUGUGAGGCCUAUUCUU
    >bta-mir-18b_MI0004732_Bos_taurus_miR-18b_stem-loop
    CUUGUGUUAAGGUGCAUCUAGUGCAGUUAGUGAAGCAGCUCAGAAUCUACUGCCCUAAAU
    >bta-mir-29a_MI0004733_Bos_taurus_miR-29a_stem-loop
    AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGG
    >bta-let-7f-2_MI0004734_Bos_taurus_let-7f-2_stem-loop
    UGUGGGAUGAGGUAGUAGAUUGUAUAGUUUUAGGGUCAUACCCCAUCUUGGAGAUAACUA
    >bta-mir-101-2_MI0004735_Bos_taurus_miR-101-2_stem-loop
    ACUGUCCUUUUUCGGUUAUCAUGGUACCGAUGCUGUAUAUCUGAAAGGUACAGUACUGUG
    
    
  2. when I do analysis without related miRNAs, the code is:

    nohup miRDeep2.pl ~/ERR558186_collapsed.fa ~/bta_genome.fa ~/ERR558186.arf none none none -t Cow -b 4 -P &
    

    the error is still here problem with ~/ERR558185_collapsed.fa.

    the ERR558185_collapsed.fa is generated using mapper.pl, and shown as following:

    head ERR558185_collapsed.fa 
    >seq_0_x385900
    GGCTGGTCCGATGGTAGTGGGTTACCAGAAC
    >seq_385900_x186326
    GGCTGGTCCGAAGGTAGTGAGTTATCTCAAT
    >seq_572226_x180010
    TGGAGTGTGACAATGGTGTTT
    >seq_752236_x133787
    TGGAGTGTGACAATGGTGTTTG
    >seq_886023_x93342
    CGCGACCTCAGATCAGA
    

    The headers in all the fasta files do not have whitespaces, I don't know where the problem is.

Does anyone have idea about this error?

Thanks a lot.

Di.

ADD COMMENTlink modified 6 weeks ago by RamRS28k • written 6 weeks ago by di.wang10

Is none a valid command line option? I don't see that being used in any of miRdeep2 tutorials. Here is a tutorial.

ADD REPLYlink modified 6 weeks ago • written 6 weeks ago by genomax87k

yes the fa files are optional, see below:

The user wishes to identify miRNAs in deep sequencing data from an animal with no related species in miRBase:

miRDeep2.pl reads_collapsed.fa genome.fa reads_collapsed_vs_genome.arf none none none 2>report.log
ADD REPLYlink modified 6 weeks ago by RamRS28k • written 6 weeks ago by di.wang10

Ok. For some programs order of program options is important. So make sure the none option is in the correct order/spot.

ADD REPLYlink written 6 weeks ago by genomax87k

Please leave the formatting as is. It is difficult to read they way you are posting this data.

Please use the formatting bar (especially the code option) to present your post better. I had done this for you but you have chosen to revert back to the original.
code_formatting

ADD REPLYlink modified 6 weeks ago • written 6 weeks ago by genomax87k

hi could you tell me how to add figures in?

ADD REPLYlink written 6 weeks ago by di.wang10

Follow this: How to add images to a Biostars post

ADD REPLYlink written 6 weeks ago by genomax87k

Instead of nohup, use a screen session. nohup interferes with writing to STDOUT/STDERR.

For the moment, just skip the nohup and &, run the task in the foreground and see if things work OK. If you see the same error, the problem definitely lies with the input files.

ADD REPLYlink written 6 weeks ago by RamRS28k

Hi,

I tried to remove nohup and &, but the error is still here.

Error: problem with /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa

But I don't think there is problem with my input file.

My input file of ERR558185_collapsed.fa is shown as below:

>seq_0_x385900
GGCTGGTCCGATGGTAGTGGGTTACCAGAAC
>seq_385900_x186326
GGCTGGTCCGAAGGTAGTGAGTTATCTCAAT
>seq_572226_x180010
TGGAGTGTGACAATGGTGTTT
>seq_752236_x133787
TGGAGTGTGACAATGGTGTTTG
>seq_886023_x93342
CGCGACCTCAGATCAGA

My code is

/usr/local/src/mirdeep2-0.1.1/bin/miRDeep2.pl \
    /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa \
    /home/workspace/wangdi/cattle_miRNA/test/5_ref/bta.fa \
    /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185.arf \
    none none none \
    -t Cow
ADD REPLYlink modified 6 weeks ago by RamRS28k • written 6 weeks ago by di.wang10

Is that all it says? "problem with FASTA"? That is a weird error message. I think the next step is to look into the code and find why that error is happening, but developers are supposed to give more verbose error messages.

EDIT

I looked at the code and it should print more messages to STDERR before it prints the "Problem with..." message - the developers seems to have done a fine job. Please give us everything it prints to STDERR and STDOUT so we can get some context on what's going on.

ADD REPLYlink modified 6 weeks ago • written 6 weeks ago by RamRS28k

Hi,

All the error reported is

#####################################
#                                   #
# miRDeep2.0.1.3                   #
#                                   #
# last change: 08/11/2019           #
#                                   #
#####################################

miRDeep2 started at 15:18:19


#Starting miRDeep2
#Starting miRDeep2
/usr/local/src/mirdeep2-0.1.3/bin/miRDeep2.pl /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558186/ERR558186_collapsed.fa /home/workspace/wangdi/cattle_miRNA/test/5_ref/bta.fa /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558186/ERR558186.arf none none none -t Cow -b 4 -P

miRDeep2 started at 15:18:19


mkdir mirdeep_runs/run_02_07_2020_t_15_18_19

#testing input files
#testing input files
sanity_check_reads_ready_file.pl /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558186/ERR558186_collapsed.fa

started: 15:18:21
Error: problem with /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558186/ERR558186_collapsed.fa
perl: warning: Setting locale failed.
perl: warning: Please check that your locale settings:
    LANGUAGE = "en_IE:en",
    LC_ALL = (unset),
    LC_CTYPE = "UTF-8",
    LANG = "en_IE.UTF-8"
    are supported and installed on your system.
perl: warning: Falling back to a fallback locale ("en_IE.UTF-8").

Do you have any idea about it?

I have tried everything I can do, including re-install the software.

My friend used the same files and the same code in a different Linux system, the code and files run OK.

So I'm wondering - it might be some problem with the server that I use? But don't know what the exact problem is.

I would be very grateful if you could help solve the problem.

Thanks a million.

ADD REPLYlink modified 5 weeks ago by genomax87k • written 5 weeks ago by di.wang10

See if this helps: https://stackoverflow.com/questions/2499794/how-to-fix-a-locale-setting-warning-from-perl

ADD REPLYlink written 5 weeks ago by genomax87k

Thanks! I'll have a try.

ADD REPLYlink written 5 weeks ago by di.wang10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1568 users visited in the last hour