Reverse Complement of each coding regions

Question

[the_cowa]

I have a fasta file which contains coding sequences as like this

>Seq1
ATGAATGACAAAATTAA
GTTATATTTAAA 
TCCTTAATAACTTACCAGAAGAGACTAATGA
CATCTCATGCCATGAAG

I need to find Reverse Complement of each line and concatenate as like this

>Seq1
TTAATTTTGTCATTCATTTTAAATATAACTCATTAGTCTCTTCTGGTAAGTTATTAAGGACTTCATGGCATGAGATG

Normally "cat fasta |tr ACGTacgt TGCAtgca | rev" will Reverse Complement but here I need to find for each CDS

[Pierre Lindenbaum]

http://emboss.sourceforge.net/apps/cvs/emboss/apps/transeq.html

transeq reads one or more nucleotide sequences and writes the corresponding protein sequence translations to file. It can translate in any of the 3 forward or three reverse sense frames, or in all three forward or reverse frames, or in all six frames.

[GenoMax]

How is this relevant for the original question @Pierre? OP is asking for reverse-complementing individual chunks of sequence on each line and then catting them together? It seems to be an odd/very specific request.

[Pierre Lindenbaum]

Complement but here I need to find for each CDS

I understand the question as :" I want to find all the ORFs in the reverse complement."

[GenoMax]

I see. You included that as final solution assuming this is done first.

I need to find Reverse Complement of each line and concatenate as like this