Question: What Does "Repmatches" In Blat'S Psl Output Mean?
0
gravatar for Tianyang Li
6.9 years ago by
Tianyang Li490
Beijing, China
Tianyang Li490 wrote:

Hi,

I have a question about what repMatches means in BLAT's PSL format.

On BLAT's site it says Number of bases that match but are part of repeats, but I'm not sure if matches are counted just one time for the same repeat or matches are counted every time it is aligned to a repeat.

Thanks!

blat • 1.8k views
ADD COMMENTlink written 6.9 years ago by Tianyang Li490
2
gravatar for JC
6.9 years ago by
JC7.7k
Mexico
JC7.7k wrote:

when you compare a sequence with a reference genome "masked", the repeat regions are lowercase, blat checks if the hit is in a lowercase region therefore it consider it's a repeat hit.

ADD COMMENTlink written 6.9 years ago by JC7.7k

Does not seem to work for me ...

Please consider this sequence and region

chr11:75258534-75258583 in HG19

ttttcaaacttcagcctgcatcagaaacatctggagggcttggtaaaatc

This regions is repeat masked in hg19 FASTA file (lower case) and my blat output still says 0 for the repMatches.

A bit confused.

ADD REPLYlink written 5.0 years ago by Duarte Molha200
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1052 users visited in the last hour