single cell INDEX & Seq
0
0
Entering edit mode
9 months ago
GiuliaAC ▴ 10

Hi everybody

The Genomic unit provided me info related to a single cell RNA seq I have to analyse. They wrote the sample ID, for each sample they wrote the index and an other info that is "Seq" (a list of 32 genomic-basis letters). In which step of the analysis should I consider the "Seq" information? What is Seq?

single cell RNA-Seq • 277 views
ADD COMMENT
0
Entering edit mode

As described this is not making a lot of sense.

"Seq" (a list of 32 genomic-basis letters)

What does this mean? Is there only one Seq per sample ID? Is this 10x genomics data?

ADD REPLY
0
Entering edit mode

10x data

transcriptomic data

single cell RNA sequencing

sample 1 --> 1 ID --> 1 index --> 1 Seq (eg: GTAATTGCAGTCGCTTCACGAGAATCGTCACG)

sample 2 --> 1 ID --> 1 index --> 1 Seq

Of course all IDs, indexes and "Seq" are different

ADD REPLY
0
Entering edit mode

Does Index sequence (or is that a code like SI-GA-A01) match first 8 basepairs from Seq?

My speculation is that Seq is actually a concatenation of 4 individual Illumina indexes that are used to label each sample in 10x technology. SI-GA-A01 code used by 10x points to those 4 individual Illumina indexes. You can find a spreadsheet with the codes and sequences on 10x support site.

ADD REPLY
0
Entering edit mode

The index is written like the code you reported So, should seq be the sequence of the index?

ADD REPLY
1
Entering edit mode

More than likely. Confirm for yourself here.

ADD REPLY

Login before adding your answer.

Traffic: 2402 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6