Question: star --readFilesIn error when using unmapped.out.mate1/2 files
0
gravatar for kokoko
6 weeks ago by
kokoko0
kokoko0 wrote:

Hello I'm very new to star. I am trying to run star by using the star's --outReadsUnmapped Fastx output (Unmapped.out.mate1/2 files). Although they are fastq files, star keeps showing me this error.

EXITING because of fatal input ERROR: could not open readFilesIn=

And this is my command

STAR  --runThreadN 12      \
  --runMode alignReads \
  --genomeSAindexNbases 10  \
  --genomeDir  ${PROJECT_DIR}ref_bacteria/ \
  --readFilesIn ${PROJECT_DIR}align/Sample_1/Sample_1Unmapped.out.mate1 \ 
  --outFileNamePrefix ${PROJECT_DIR}align/Sample_1/Sample_1    \
  --outFilterMismatchNoverLmax 0.02                            \          
  --outSAMtype BAM SortedByCoordinate  \
  --outSAMattributes All               \
  -quantMode GeneCounts                \
  --outSAMunmapped Within              \
  --sjdbGTFfile ${PROJECT_DIR}ref_bacteria/genes.gtf \
  --sjdbOverhang 100;

done

Can you tell me the reason why i cannot use this Unmapped.out.mate1/2 files?

Thanks.

rna-seq star • 121 views
ADD COMMENTlink written 6 weeks ago by kokoko0

There is no --outReadsUnmapped Fastx in your command line

Furthermore the error says that your --readFIlesin is not correct :

--readFilesIn ${PROJECT_DIR}align/Sample_1/Sample_1Unmapped.out.mate1

Should be a path to fastq file like :

--readFilesIn ${PROJECT_DIR}align/Sample_1/Sample_1.fastq
ADD REPLYlink written 6 weeks ago by Bastien Hervé4.7k

I think they are using the --outReadsUnmapped Fastx output as the input for this command.

Is the ${PROJECT_DIR} variable ending in / ?

Can you head the Sample_1Unmapped.out.mate1 file ?

ADD REPLYlink written 6 weeks ago by benformatics1.9k

Yes. ${PROJECT_DIR} is starting and ending in /. And I can head that file and it was certainly fastq file.

it shows

@A00718:115:HT7HLDSXX:4:1128:26549:26616 0:N:  00
GTCACCATGATGTCAGAGACAGGAATAACCTAAAATCCTCTGAGGGGTAGGTAATTCCAGACCTGGTGTTAAAAGGCCCCTCAGCAACCTTTTGTCATCAC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00718:115:HT7HLDSXX:4:1128:3613:26631 0:N:  00
GTTCAGCACAAACACTCCCTTGTCCACAGCCACTAGCCCAACTCGCGCCCCCTGTTTAACTTCAATACTGAGTGTCGTTTGAAGCCCAGGTGCGAGATGTT
+
::FFFF:F,:,,FF,F,FFFF,F,FFFFFF:F,FF::,:,F:F:,,,F,,::F:,,F,,,,FF:FF,F:F:,F,FF,:,,:,:FFFF,,:,,,::FFF:,F
@A00718:115:HT7HLDSXX:4:1128:6198:26631 0:N:  00
ATCAAATACAAAGCTTTTTACAAAATTTTGAAGGCTGAACTCACTATGCACTAAGAGTTGTGCAAAGGGATTTACATATGTAATCTCAGTTAGTACTCAAA
ADD REPLYlink modified 6 weeks ago by Bastien Hervé4.7k • written 6 weeks ago by kokoko0

benformatics is right. I used --outReadsUnmapped Fastx from another running as a input

ADD REPLYlink written 6 weeks ago by kokoko0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1123 users visited in the last hour