star --readFilesIn error when using unmapped.out.mate1/2 files
0
0
Entering edit mode
11 months ago
kokoko • 0

Hello I'm very new to star. I am trying to run star by using the star's --outReadsUnmapped Fastx output (Unmapped.out.mate1/2 files). Although they are fastq files, star keeps showing me this error.

EXITING because of fatal input ERROR: could not open readFilesIn=

And this is my command

STAR  --runThreadN 12      \
  --runMode alignReads \
  --genomeSAindexNbases 10  \
  --genomeDir  ${PROJECT_DIR}ref_bacteria/ \
  --readFilesIn ${PROJECT_DIR}align/Sample_1/Sample_1Unmapped.out.mate1 \ 
  --outFileNamePrefix ${PROJECT_DIR}align/Sample_1/Sample_1    \
  --outFilterMismatchNoverLmax 0.02                            \          
  --outSAMtype BAM SortedByCoordinate  \
  --outSAMattributes All               \
  -quantMode GeneCounts                \
  --outSAMunmapped Within              \
  --sjdbGTFfile ${PROJECT_DIR}ref_bacteria/genes.gtf \
  --sjdbOverhang 100;

done

Can you tell me the reason why i cannot use this Unmapped.out.mate1/2 files?

Thanks.

star RNA-Seq • 555 views
ADD COMMENT
0
Entering edit mode

There is no --outReadsUnmapped Fastx in your command line

Furthermore the error says that your --readFIlesin is not correct :

--readFilesIn ${PROJECT_DIR}align/Sample_1/Sample_1Unmapped.out.mate1

Should be a path to fastq file like :

--readFilesIn ${PROJECT_DIR}align/Sample_1/Sample_1.fastq
ADD REPLY
0
Entering edit mode

I think they are using the --outReadsUnmapped Fastx output as the input for this command.

Is the ${PROJECT_DIR} variable ending in / ?

Can you head the Sample_1Unmapped.out.mate1 file ?

ADD REPLY
0
Entering edit mode

Yes. ${PROJECT_DIR} is starting and ending in /. And I can head that file and it was certainly fastq file.

it shows

@A00718:115:HT7HLDSXX:4:1128:26549:26616 0:N:  00
GTCACCATGATGTCAGAGACAGGAATAACCTAAAATCCTCTGAGGGGTAGGTAATTCCAGACCTGGTGTTAAAAGGCCCCTCAGCAACCTTTTGTCATCAC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00718:115:HT7HLDSXX:4:1128:3613:26631 0:N:  00
GTTCAGCACAAACACTCCCTTGTCCACAGCCACTAGCCCAACTCGCGCCCCCTGTTTAACTTCAATACTGAGTGTCGTTTGAAGCCCAGGTGCGAGATGTT
+
::FFFF:F,:,,FF,F,FFFF,F,FFFFFF:F,FF::,:,F:F:,,,F,,::F:,,F,,,,FF:FF,F:F:,F,FF,:,,:,:FFFF,,:,,,::FFF:,F
@A00718:115:HT7HLDSXX:4:1128:6198:26631 0:N:  00
ATCAAATACAAAGCTTTTTACAAAATTTTGAAGGCTGAACTCACTATGCACTAAGAGTTGTGCAAAGGGATTTACATATGTAATCTCAGTTAGTACTCAAA
ADD REPLY
0
Entering edit mode

benformatics is right. I used --outReadsUnmapped Fastx from another running as a input

ADD REPLY
0
Entering edit mode

Hello! I guess I could be late for this topic, but I'm trying to do a very similar analysis and I'm quite desperate, cause I don't really know how to.

Did you finally get to analyze those _unmapped.out.mate1/2 files? Is there any way to convert them to .fastq format?

And, apart from that, which bacteria reference database did you use?

I'm in my first days of analyzing RNAseq data and I just need to go on analyzing those unmapped sequences.

Thank you so much in advanced :)

ADD REPLY
0
Entering edit mode

Hello, the unmapped files from STAR are fastq file. If you do :

head Sample_1Unmapped.out.mate1

You will see there are fastq formatted, but I don't know why STAR does not put the .fastq extension.

Anyways, you can just add the extension modifying the name of the file :

mv Sample_1Unmapped.out.mate1 Sample_1Unmapped.out.mate1.fastq
ADD REPLY
0
Entering edit mode

Thank you so much!! I didn't expect it to be that easy... but indeed it worked :) Thank you!

ADD REPLY

Login before adding your answer.

Traffic: 1479 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6