Question: Dual indexing i5/i7 with ATAC-seq
0
gravatar for e.antunes
5 months ago by
e.antunes0
e.antunes0 wrote:

Hello,

I am constructing an ATAC-seq library using the standard Illumina kit (Nextera DNA Flex Library Prep, FC-121-1030). A previous user suggested dual indexing to minimise index hopping which I am grateful for. We have access to a Hiseq X-Ten (paired-end 100bp) and illumina suggests to use the reverse complement of the Index (i5) adapter sequence:

[url]https://emea.support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences-1000000002694-14.pdf[/url]

I'm wondering if they mean that I need to include the reverse complement of the unique adapter into the primer that I will use to amplify my tagmented DNA, or whether this is specified at the sequencer to accommodate for differences between in how reads are generated?

For example, a standard i5 adapter = AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC

What should I order to amplify my transposed libraries? The H502 i5 index: unique i5 bases in adapter = CTCTCTAT, does that mean I would order a primer with the reverse complement (ATAGAGAG) for the unique portion of an i5 standard index? = AATGATACGGCGACCACCGAGATCTACAC [ATAGAGAG] TCGTCGGCAGCGTC instead of AATGATACGGCGACCACCGAGATCTACAC [CTCTCTAT] TCGTCGGCAGCGTC as was used in this protocol presumably because they used a different sequencer: [url]https://www.encodeproject.org/documents/4a2fc974-f021-4f85-ba7a-bd401fe682d1/@@download/attachment/RenLab_ATACseq_protocol_20170130.pdf[/url]

From the original ATAC-seq protocol, they add the following bases to the 3' end of a standard i5 adapter that doesn't contain a unique index sequence. I'd imagine this is to mitigate loss of the 8 base unique index for PCR, but they've also added a few bases (AGATGT) to the 3' end of the i7 adapters that do contain a unique index sequence. Should I include this (AGATGTG) to my i5 primer order and can I use these with the i7 adapters as given in the in the Buenrostro 2013 protocol which include the extra 3' bases (AGATGT)?

Best, Eric

ADD COMMENTlink modified 5 months ago • written 5 months ago by e.antunes0

You could do what @ATpoint said below or order a kit.

Edit: Took out example link since it was not appropriate.

ADD REPLYlink modified 5 months ago • written 5 months ago by GenoMax95k

This kit is for TruSeq, but ATAC-seq is based on the Nextera adapter, so this will not work.

ADD REPLYlink modified 5 months ago • written 5 months ago by ATpoint44k

Brilliant! Thanks to you both for your replies and information. The excel spreadsheet is a game changer.

Best, Eric

ADD REPLYlink written 5 months ago by e.antunes0
1

You can accept @ATPoint's answer (green check mark) to provide closure to the thread.

ADD REPLYlink written 5 months ago by GenoMax95k
1

Sure thing. I also edited my post and included a paper which lists these primers from the lab that developed ATAC-seq in case you want to double-check with an "official" resource.

ADD REPLYlink written 5 months ago by ATpoint44k
2
gravatar for ATpoint
5 months ago by
ATpoint44k
ATpoint44k wrote:

I attach a link below from which you can download an extensive list of ATAC-seq primers. These are dual-indexing primers and you can order them just as they are listed in the Excel sheet. I got them from (if memory serves) one of the ATAC-seq publications of the Greenleaf lab. For dual-indexing use the Custom Barcodes Adapter 1 (index i5) together with the Custom Barcodes Adapter 2 (index i7). Please be sure not to customly add any nucleotides to primers, simply use these published ones and you are good to go. By the way, the primers are the exact same for any Illumina machine, no matter if you sequence on a MiSeq, Nextseq, HiSeq or Novaseq. The only difference is that some machines report the sequence as reverse complement (?, not sure, genomax can you clarify?) but this is not important for the primers, they are always the same. Ask your facility for details on how they want you to send the index sequences you use.

You can always use the dual-index primer no matter if the actual sequence run is dual- or single-indexed. In the latter case one index is simply not being read. Just order the primers as salt-free oligos, make 100µM stocks and dilute them to 25µM for use in the PCR (2.5µl each), no magic here.

I used the attached primers extensively on different Illumina platforms throughout the years so don't worry, they work.

https://uni-muenster.sciebo.de/s/C9qS36mUaXV1jR6


Edit: Here is a more "official" source rather than a random link at an online community (and in case the link breaks). The primer sequences are also listed in the supplementary material of this paper of the Greenleaf lab, see Supplementary Table 3: https://www.nature.com/articles/s41467-018-05887-x#additional-information

ADD COMMENTlink modified 5 months ago • written 5 months ago by ATpoint44k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1922 users visited in the last hour
_