Biopython Translate With N In The Sequence

Question

[Richard]

Hi. I have the following sequence:

CAGGTGCAGCTGGTGCAGAGCGGCAGCGAGCTGAAGAAACCTGGCGCCTCCGTGAAGGTGTCCTGCAAGGCCAGCGGCTACACCTTCACCAGCTACGCCATGAACTGGGTCCGCCAGGCCCCAGGCCAGGGACTGGAATGGATGGGCTGGATCAACACCAACACCGGCAACCCCACCTACGCCCAGGGCTTCACCGGCAGATTCGTGTTCAGCTTCGACACCAGCGTGTCCACCGCCTACCTGCAGATCTGTAGCCTGAAGGCCGAGGACACCGCCGTGTATTNNTGTGCGA

There are a couple of N's in there. I would like to use biopython's translate function on the seuqence, but this throws the following error: "Codon TNN is invalid"

Is there a way to get this function to return a default amino acid such as 'X' when the translation is unsuccessful? Any ideas?

[Giovanni M Dall'Olio]

which version of biopython are you using?

Answer 1

[Geparada]

I don't have any problem to translate your sequence using biopyhton

>>> from Bio.Seq import Seq
>>> dna = Seq("CAGGTGCAGCTGGTGCAGAGCGGCAGCGAGCTGAAGAAACCTGGCGCCTCCGTGAAGGTGTCCTGCAAGGCCAGCGGCTACACCTTCACCAGCTACGCCATGAACTGGGTCCGCCAGGCCCCAGGCCAGGGACTGGAATGGATGGGCTGGATCAACACCAACACCGGCAACCCCACCTACGCCCAGGGCTTCACCGGCAGATTCGTGTTCAGCTTCGACACCAGCGTGTCCACCGCCTACCTGCAGATCTGTAGCCTGAAGGCCGAGGACACCGCCGTGTATTNNTGTGCGA")    
>>> dna.translate()
Seq('QVQLVQSGSELKKPGASVKVSCKASGYTFTSYAMNWVRQAPGQGLEWMGWINTN...XCA', ExtendedIUPACProtein())

The TNN codon is valid, and it's translated to X, just as you suggested.

Cheers!!

[Richard]

AHHH, Looks like my problem was my alphabet. I hadn't noticed that I was using UnambiguousDNA. Using generic_dna fixed the issue

[Giovanni M Dall'Olio]

please mark the answer as accepted if you think that it's correct. You and the person who answered will receive extra score.

[Giovanni M Dall'Olio]

thank you for marking it!