Question: Adapter trimming by Trimmomatic - Nextera Library
0
gravatar for mimi
4 months ago by
mimi0
mimi0 wrote:

Hi, I have paired-end read data prepared by illumina Nextera. I'm trying to remove the adapter using Trimmomatic.

illumina adaper sequence manual (p.3) says that the following sequence is used for Read 1 and Read 2 adapter trimming. CTGTCTCTTATACACATCT

However, Trimmomatic have reverse complementary sequences as PrefixNX / 1 and PrefixNX / 2. Is it necessary to specify CTGTCTCTTATACACATCT in Trimmomatic?


NexteraPE-PE.fa (supplied by Trimmomatic):

'>PrefixNX/1

AGATGTGTATAAGAGACAG

'>PrefixNX/2

AGATGTGTATAAGAGACAG

'>Trans1

TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

'>Trans1_rc

CTGTCTCTTATACACATCTGACGCTGCCGACGA

'>Trans2

GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

'>Trans2_rc

CTGTCTCTTATACACATCTCCGAGCCCACGAGAC

ADD COMMENTlink modified 4 months ago by colindaven2.6k • written 4 months ago by mimi0
1
gravatar for colindaven
4 months ago by
colindaven2.6k
Hannover Medical School
colindaven2.6k wrote:

We couldn't find a good way to do this in Trimmomatic (our preferred trimmer) and started using trim-galore in our pipeline (https://github.com/MHH-RCUG/Wochenende ) instead for nextera transposase sequences.

We found trim-galore to be much better at getting rid of residual nextera adapters. Trimmomatic did not remove adapters despite having the exact adapter and sequence added to it's reference DB, and a few (~ 0.1-0.5 %) were left in the output. We tried multiple prefixes etc too, and also another tool, fastp.

ADD COMMENTlink modified 4 months ago • written 4 months ago by colindaven2.6k

Thank you for the information! I'll try it.

ADD REPLYlink written 4 months ago by mimi0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1876 users visited in the last hour
_