Bizarre CIGAR string
0
0
Entering edit mode
24 months ago
2nelly ▴ 310

Hi all,

I was given a bam file to process for variant calling. However GATK gives CIGAR error. Checking the respective aligned reads I noticed a very strange possible error. Do you have any idea what can cause this misconception with the CIGAR string after alignment with bowtie?

A00129:298:H7JGHDSXX:1:1105:9109:27853  147 19  4511282 60  150S    =   4511317 -294    GGTGACCCCACTGCAGACAGTGTCCTTGGTACCGGTCAGCACGGTCTTGGCCGTGTCTACACCCGTCTGGACGGCCCCCTTGGCCACATTCGCAGCACCGGTCACCCCACTGCAGACGGTGTCCTTGGTACCAGTTAGGACAGTCTTGGT  FFFFFFFF:FFFFFFFFF:FF:F:FFFFFFFFFF:FFFFFF:F,F,F:FF:FFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF  NM:i:0  MD:Z:64A49C2A1C0A16A0C11    AS:i:115    XS:i:73 ra:i:1  cl:i:0

A00129:298:H7JGHDSXX:1:1105:9109:27853  99  19  4511317 60  150M    =   4511461 294 GTCCAGGCCCCCCTGGACGGCCCCTTTGGCCACATTCGCAGCACCGGTCACCCCACTGCCAAGGGTGTTCTTTGTACCTGTTGCGATATTTTGGGTCGTTTTCAGCCCAGTTTGCACAGCACCCTTGGCCACGTTCACAGCACCGGTGAC  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF::FFFFF:FFFFFFFF:FFF:FFFFFF:FFFFF  NM:i:2  MD:Z:33T102G13  AS:i:140    XS:i:49 na:i:1  cl:i:2

How is it possible to get 150S in CIGAR string? The whole read is soft clipped but aligned!!!! This is bizarre. Unless the file is modified.

Any suggestions?

Thank you

alignment sequencing next-gen • 561 views
ADD COMMENT
1
Entering edit mode

are you using bowtie 1? The alignment is marking: Pair 1 is aligned in chr19:4511317, Pair 2 is not aligned but should be at 4511282. My suggestion is to align with BWA

ADD REPLY
0
Entering edit mode

Let s say that this is a task they gave me to do as a test. I know the potential solutions like convert back to fastq and realign. However, I suspect that this is a kind of pitfall they set me up on purpose. I just want to know what can cause this strange attitude apart from modifying the file on purpose. And yes it is bowtie1

ADD REPLY

Login before adding your answer.

Traffic: 1354 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6