Kover trying to run the data example from kover2_paper
0
0
Entering edit mode
6 months ago
nobu.kim66 ▴ 20

I'm trying to run the example here: https://github.com/aldro61/kover2_paper/tree/master/data to reproduce the paper's results.

I'm stuck at step 3 with command:

kover dataset create from-tsv --genomic-data genome_paths.tsv --phenotype-description "Kanamycin resistance" --phenotype-metadata 'mycobacterium tuberculosis'/kanamycin/metadata.tsv --output example2.kover --progress

I'm getting an error:

(kover) T00057442@radius:~/RA/kover/kover2_paper/data$ \kover dataset create from-contigs --genomic-data genome_paths.tsv --phenotype-description "Kanamycin resistance" --phenotype-metadata 'mycobacterium tuberculosis'/kanamycin/metadata.tsv --output example2.kover --progress
Traceback (most recent call last):
  File "/home/T00057442/RA/kover/kover/bin/kover", line 1192, in <module>
    CommandLineInterface()
  File "/home/T00057442/RA/kover/kover/bin/kover", line 1150, in __init__
    getattr(self, args.command)()
  File "/home/T00057442/RA/kover/kover/bin/kover", line 1170, in dataset
    getattr(dataset_tool, args.command)()
  File "/home/T00057442/RA/kover/kover/bin/kover", line 250, in create
    getattr(creation_tool, args.datasource)()
  File "/home/T00057442/RA/kover/kover/bin/kover", line 159, in from_contigs
    progress=args.progress)
  File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/site-packages/kover/dataset/create.py", line 371, in from_contigs
    progress=progress)
  File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/site-packages/kover/dataset/tools/kmer_count.py", line 37, in contigs_count_kmers
    "-progress", str(progress)])
  File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/subprocess.py", line 172, in call
    return Popen(*popenargs, **kwargs).wait()
  File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/subprocess.py", line 394, in __init__
    errread, errwrite)
  File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/subprocess.py", line 1047, in _execute_child
    raise child_exception
OSError: [Errno 2] No such file or directory

I'm not sure what files they are referring to but in step 2, genome_paths.tsv was not created in genomes_dir but rather in the directory above it so I am referring to that as an argument to my command above.

I also used from-contigs because this is what I get with the other options: from-tsv shows error:

Traceback (most recent call last):
  File "/home/T00057442/RA/kover/kover/bin/kover", line 1192, in <module>
    CommandLineInterface()
  File "/home/T00057442/RA/kover/kover/bin/kover", line 1150, in __init__
    getattr(self, args.command)()
  File "/home/T00057442/RA/kover/kover/bin/kover", line 1170, in dataset
    getattr(dataset_tool, args.command)()
  File "/home/T00057442/RA/kover/kover/bin/kover", line 250, in create
    getattr(creation_tool, args.datasource)()
  File "/home/T00057442/RA/kover/kover/bin/kover", line 97, in from_tsv
    progress_callback=progress)
  File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/site-packages/kover/dataset/create.py", line 155, in from_tsv
    kmer_count = get_kmer_count(tsv_path)
  File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/site-packages/kover/dataset/create.py", line 136, in get_kmer_count
    raise Exception()
Exception

There are no kmer_count's in the genome_paths.tsv like in the kmer_matrix.tsv used in the tutorial here: https://aldro61.github.io/kover/doc_tut_scm.html so getting this error makes sense.

I also tried from-reads

   Traceback (most recent call last):
      File "/home/T00057442/RA/kover/kover/bin/kover", line 1192, in <module>
        CommandLineInterface()
      File "/home/T00057442/RA/kover/kover/bin/kover", line 1150, in __init__
        getattr(self, args.command)()
      File "/home/T00057442/RA/kover/kover/bin/kover", line 1170, in dataset
        getattr(dataset_tool, args.command)()
      File "/home/T00057442/RA/kover/kover/bin/kover", line 250, in create
        getattr(creation_tool, args.datasource)()
      File "/home/T00057442/RA/kover/kover/bin/kover", line 224, in from_reads
        progress=args.progress)
      File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/site-packages/kover/dataset/create.py", line 485, in from_reads
        files = [join(reads_folder_by_genome_id[id], file) for file in listdir(reads_folder_by_genome_id[id])
    OSError: [Errno 20] Not a directory: '/home/T00057442/RA/kover/kover2_paper/data/genomes_dir/1773.204.fna'

1773.204.fna looks like a fasta file so this error also makes sense.

>JKXM01000001   Mycobacterium tuberculosis strain MAL020165 adOWA-supercont1.1.C1, whole genome shotgun sequence.   [Mycobacterium tuberculosis strain MAL020165 | 1773.204]
GCCGTCGCCGCCCTGGCCGCCGGCCCCGCCGTTTCCGCCGCCGCCGCCATCGCCGATGAT
GTTTTCCCCGCCCTTGCCGCCAGCCCCAGCGTTCCCGCCGGCTCCGCCACTGGCGCCGGT
GCCGCCGGGTGCAACGGCGTTGGCGCCGTTACCGCCGTTGCCGCCTTTGCCCCCGGTGTC
TGCAAAGTCGGGGGTCGCACCCTGCGCGGCGCGGGTCACGCCGTCACCGCTGAGCCCCCC
GAGCCCGCCAGCGCCGCTGAAGCCAGGATTGCCGCCGTTGCCGCCATGGCCGCCGTTGGC
ACCGGGTGCGACGGCGTTGCCGCCGGTCCCGCCGACCCCACCGTTGCCGCCTTTACCACC
GTCCTGGCCACGCTCGCCCGCGGTGGTGGCATTGGCACCCTCGGCACCACTACCACCGAG
CCCGCCGTCTGCGCCGCGGCCGCCAGTCCCACCGGCCCCGCCATTGCCGGCGAGAGTTCC
GCCGTCGCCGCCGGCGCCGCCCTGGCCGCCGTTGCCGCCGCTATTGCCTTTGCCACCGAC
TGCGCCCGAATCGCTCGCGTTCGTCCCTGCGGCGCCGTTGGCGCCGTTGCCGCCGGCGCC
GCCGTTGCCGACCAGCCCGCCATGGCCGCCGGGTCCGCCGTTGGCGCCGTTGGTGCCCGC
GGTGGTGGCGTTGGCGCCGTTGCCGCCGGCACCGCCGTTGCCGCCGCTGGTGGGGGTGGC
GCCGATGGCGCCCTGAGCGCCGGTGATGGAGCCGGCTCCGCCGGTGCCTCCGGCCCCGCC
GGTGCCGGGGTTGCCGCCGTTGCCGCCGTGACCGCCGGCACCTGCGTTGAAGGCCTGGTT
GCCGTTGGCGCCGGCTCCGCGGTCACCGCCGACGCCACCAGCGCCGCCGGTCCCGCCGGC
CCCGCCGGCGCCTTGGCCGCCCAGCAGGCTGATCAGGCCGCCGGCCCCGCCGACCCCGCC
GACCCCACCGGCACCGCCGCTACCACCGGCACCGCCGGCCTGTCCGGTGGCAATCACCAG
AGAATGGCCGCCCCCGCCGGCCCCACCGGCCCCGCCGATACCGCCGTCCCCGCCGGCCCC
GCCGGCACCGGCCAGCCAGCCACCCCGGCCCCCGGCCCCGCCATCGCCGGCGTCGCCGCC
GACCCCACCGGACGTACCGTGCGGGGACAAGTCCTCACCGGCTGCGCCGGCCACACCCTC
.
.
.

which leaves from-contigs as a default last option which as mentioned first did not work.

genome_paths.tsv looks like:

1448490.3   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1448490.3.fna
1773.5071   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5071.fna
1773.5072   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5072.fna
1773.5073   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5073.fna
1773.5074   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5074.fna
1773.5075   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5075.fna
1773.5076   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5076.fna
1773.5077   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5077.fna
1773.5078   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5078.fna
1773.5080   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5080.fna
1773.5081   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5081.fna
1773.5082   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5082.fna
1773.5086   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5086.fna
1773.5087   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5087.fna
1773.5089   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5089.fna
1773.5090   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5090.fna
1773.5091   /home/nobu/Desktop/BioInformatics/ResearchAssistant/kover2_paper/data/genomes_dir/1773.5091.fna
.
.
.

with index numbers starting from 1 in the very left.

Here: https://aldro61.github.io/kover/doc_dataset.html#creating-a-dataset Reading that also makes me think from-contigs is the correct choice. Does anyone know what I should be doing? I am going to use Pycharm debugger to see what is happening at create.py but I am new to bioinformatics so any advice is appreciated. I moved genome_paths.tsv into genomes_dir and tried using absolute paths but still getting errors. The command:

(kover) T00057442@radius:~/RA/kover/kover2_paper/data/genomes_dir$ kover dataset create from-contigs --genomic-data /home/T00057442/RA/kover/kover2_paper/data/genomes_dir/genome_paths.tsv --phenotype-description "Kanamycin resistance" --phenotype-metadata /home/T00057442/RA/kover/kover2_paper/data/'mycobacterium tuberculosis'/kanamycin/metadata.tsv --output example2.kover --progress

and the error:

Traceback (most recent call last):
  File "/home/T00057442/RA/kover/kover/bin/kover", line 1192, in <module>
    CommandLineInterface()
  File "/home/T00057442/RA/kover/kover/bin/kover", line 1150, in __init__
    getattr(self, args.command)()
  File "/home/T00057442/RA/kover/kover/bin/kover", line 1170, in dataset
    getattr(dataset_tool, args.command)()
  File "/home/T00057442/RA/kover/kover/bin/kover", line 250, in create
    getattr(creation_tool, args.datasource)()
  File "/home/T00057442/RA/kover/kover/bin/kover", line 159, in from_contigs
    progress=args.progress)
  File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/site-packages/kover/dataset/create.py", line 371, in from_contigs
    progress=progress)
  File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/site-packages/kover/dataset/tools/kmer_count.py", line 37, in contigs_count_kmers
    "-progress", str(progress)])
  File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/subprocess.py", line 172, in call
    return Popen(*popenargs, **kwargs).wait()
  File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/subprocess.py", line 394, in __init__
    errread, errwrite)
  File "/home/T00057442/anaconda3/envs/kover/lib/python2.7/subprocess.py", line 1047, in _execute_child
    raise child_exception
OSError: [Errno 2] No such file or directory

Edit: Ran it in Pycharm, I don't think it is a Python issue/bug so I am stuck again. Any help or suggestion is welcome.

kover • 208 views
ADD COMMENT

Login before adding your answer.

Traffic: 1550 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6