Using augustus gene model gff as STAR input
Entering edit mode
13 months ago

Hi all, I'm trying to do a DGE analysis on a non-model organism that has a published Augustus gff file & accompanying fasta file. I keep getting this error:

terminate called after throwing an instance of 'std::out_of_range'
  what():  vector::_M_range_check
/home/alice/ line 27: 31318 Aborted                 STAR --runMode genomeGenerate --genomeDir $genomeDir --sjdbGTFfile $GTF --genomeFastaFiles $REFERENCE --runThreadN 4

I believe that the gff and fasta may not be labelled the same. I have included a small sample of what the gff and fasta look like.


# start gene scaffold1.g8
scaffold1       AUGUSTUS        gene    71594   80958   0.07    -       .       ID=scaffold1.g8
scaffold1       AUGUSTUS        transcript      71594   80958   0.07    -       .       ID=scaffold1.g8.t1;Parent=scaffold1.g8
scaffold1       AUGUSTUS        transcription_end_site  71594   71594   .       -       .       Parent=scaffold1.g8.t1


# coding sequence = [atggggaatcgtggaatggaagatttaatccctatcgtaaacaagttgcaagatgcatttgcacaaattggtatagagt


# cacgacctccacctgtaccaagtcgaccttag]





scaffold1 len=5136627


Please let me know if you have any idea how to make the files similar, or any advice on how to make this work.

Thanks in advance!!

RNA-Seq gff genemodels genemodel • 338 views

Login before adding your answer.

Traffic: 2850 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6