Question: How to retrieve an individual read with fastq-dump
0
gravatar for wmorgan485
15 days ago by
wmorgan4850
wmorgan4850 wrote:

After performing a blastn search against an SRA accession, I want to retrieve several dozen matching reads using SRA Toolkit. As a test, I tried this command to get one of the matching reads:

fastq-dump  --split-spot  SRR10201511.86616936.2

The expected result was a fastq file like this:

@SRR10201511.86616936.1 86616936 length=151 ATAATAAGAAAGCTGTAATGAAAATAGCCCAAACGAATAAAGGCTGTCTCTTATACACATCTAAAATATTTTTTATTAACTTAAATTAAAAAGCGAATAAAATTAAGAAAGCAATCATTAAACAGAATAAAGCAATAGATTCAGTTAAAGC
+SRR10201511.86616936.1 86616936 length=151 
AAFFFJJJJJJJJFJJFJJJFJJJJJJJJJJFJJJJFFJJJJJJFJJJJJJJJJJJJJJJJFJJJFJJJFJAJJJJFJFJJJJJJFAJAJJJF7AAJJFJJJJJJJJJJJFJFJJJJJJJJJJJ<FJ7JFFFJFJFJJJJF-<77AFFJAA 
@SRR10201511.86616936.2 86616936 length=151 
ACATAATATGTTATTACAATCTGCAAAATTTATTGGTGCTGGATTAGCTACTATTGGATTAGCAGGTGCTGGTATCGGTATCGGTTCAGTATTTAGTTCATTAGTTTTAGGTATTTCTAGAAACCTTTCTTTACAACAAGATNNNNNNNNN
+SRR10201511.86616936.2 86616936 length=151 
AAFFFJFF7AJJJJFJJJJJFJJJJJJFJJFJFJJFJFFJJAJJJJJJFFJJFJJJFJJJJ7JFJJF<AJJAJFJJFJJJJ<JJFFFJJJJJJJJFFAJJJJJ<J-7JJJJF-<FFJJJFJAAF<-AFJFJJJJF<FF-7<F#########

But instead I retrieved thousands of reads in a ~3 GB file. The first read looks like this:

@SRR10201511.86616936.2.1 1 length=151
NTTCAGCCTTGCGACCATACTCCTGTCTCTTATACACATCTAGATGTGTATAAGAGACAAGTACTAATACAGCAAAAAGACTTGTGCGATTTTTCAAGCGCAGCAACAACCACTGGCAAAGACCCCAACAGGAAGAAAGACTATAAGATCG
+SRR10201511.86616936.2.1 1 length=151
#AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFFJFJJJJJJJJJFJJJJJJJJJJ<JJJJJJJJJJJJJJJJJFF<AFAFFJJAAA---FAJJFJFF<FJFFF7--F---7FA<7F--))7A)--7AA<AFA-7----7A-<-<-
@SRR10201511.86616936.2.1 1 length=151
NAAAGTCTTTCTTCCTGTTAGAGTCTTTGCCAGTGGTTGTTGCTGCGCTTGAAAAATCGCACAAGTCTTTTTGCTGTATTAGTACTTGTCTCTTATACACATCTAGATGTGTATAAGAGACAGGAGAATGGTCGCAAGGCTGNNNNNNNNN
+SRR10201511.86616936.2.1 1 length=151
#AAFFJJJJJJJJ<FFJ-FJJJJ<<FJJJJFJJJJJ7FJJJJJ-FJJJ7AFJJJJJJJJJJJJJJFJFFJ-A<J7A<AFJJJJJJJFJ7FAF<FJA7FJAJ--A7<--7-7-<7FAAAFJJJF7JJ-7-7--<<-7FJ77--#########

Why am I not retrieving the desired, single read with fastq-dump?

rna-seq fastq-dump sra • 121 views
ADD COMMENTlink written 15 days ago by wmorgan4850
2
gravatar for h.mon
15 days ago by
h.mon31k
Brazil
h.mon31k wrote:

See this answer: A: Downloading individual reads from SRA

ADD COMMENTlink written 15 days ago by h.mon31k

Thanks! I should have said in my initial post that I had already seen the "Downloading individual reads from SRA" post and given it a try without success. Surprisingly, when I use the example command in that post (modified here to include the missing parameter for the --fasta option), no file is returned:

fastq-dump -A SRR1803613 -N 479767 -X 479767 --fasta 60

At that point, I tried alternatives without success, but your reply did prompt me to give this approach another try with my accession and spot id. Indeed, I was able to retrieve the expected result (as shown in my original post) using this command:

fastq-dump -N 86616936 -X 86616936 --split-spot --readids  --stdout  SRR10201511
ADD REPLYlink written 14 days ago by wmorgan4850
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1270 users visited in the last hour