STRT-seq barcode file
0
0
Entering edit mode
10 months ago

does STRT-seq protocol has any barcode file?

AATGATACGGCGACCACCGATNNNNNNGGGXX..XXCTGTCTCTTATACACATCTGACGCXXXXXXXXTCGTATGCCGTCTTCTGCTTG i.e (21bp of Sequence) + (6bp UMI) + (Variable bp of Sequence again) + "GACGC" + (8bp Cell Barcode) + (Variable bp of Sequence again)

this is my barcode format, how should I write barcode pattern for UMI tool extract?

barcode • 281 views
ADD COMMENT

Login before adding your answer.

Traffic: 1425 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6