Question: Interpretation of code snippet.
0
gravatar for projetoic
7 weeks ago by
projetoic0
projetoic0 wrote:

I'm not able to understand what this excerpt means ... Does he say he can modify the genetic code?

As written above, each is a method of the codonw.CononSeq object, e.g.

import codonw
cseq = codonw.CodonSeq("ATGAATATGCTCATTGTCGGTAGAGTTGTTGCTAGTGTTGGGGGAAGCGGACTTCAAACG")
cseq.cai()

The return type can be a simple value, pd.Series, or pd.DataFrame.

The genetic codes can be specified by setting the CodonSeq.genetic_code property with a pd.Series whose index is a codon and value is the single letter amino acid. Instantiate an object and see CodonSeq.genetic_code for more details.

Some indicies have an option of reference values to choose from (e.g. CodonSeq.fop). Several references values can be chosen by specifying the corresponding integer. If you'd like to have user-provided reference values, please implement this functionality and make a pull-request.

https://pypi.org/project/codonw-slim/

documentation code python gene • 149 views
ADD COMMENTlink modified 7 weeks ago by h.mon32k • written 7 weeks ago by projetoic0
2
gravatar for massa.kassa.sc3na
7 weeks ago by
massa.kassa.sc3na340 wrote:

Just read the source code :) (There is much better information about the cai function.)

https://github.com/smsaladi/codonw-slim/blob/1035b28163cb4fa1e24c3762df258e2b65308a03/codonw/codonwlib/codonw.pyx#L116

Regarding the user-provided reference values, it seems that only E. coli, B. subtilis and S. cerevisiae reference values are implemented in the library, if you need some different organism, you need to add them yourself.

Hope this helps.

ADD COMMENTlink modified 7 weeks ago • written 7 weeks ago by massa.kassa.sc3na340
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1542 users visited in the last hour
_