Cigar And Sequence Length Inconsistent
Entering edit mode
10.0 years ago
Bnfoguy ▴ 70

Hello Everyone,

I have been working with cancer exome data and I have two fastq files. I put these files into stampy for paired end mapping and got a sam file. Unfortunately, the stampy script crashed after running close to 10 hours. When I tried to convert the .sam file to bam for mat I get the following error:

CIGAR and Sequence length are inconsistent

Here are the offending lines:

ERR035488.960541        147     chr1    27205782        99      72M     =       27205550        -304    TATGCCTCCTTGAGTGTCAGTGGCGTGATCTTGGCCCGGCTCACACCGGCCGGCAGGAAGTCTAGTAGGCAG       8<=21<?7A<<DA8>>@CEDE.D<DDB?@;BAC6;48EB@AE4>4@&FEB6FEFGFD1GFAC@DFAFBCBB>        PQ:i:46 SM:i:96 UQ:i:0  MQ:i:96 XQ:i:15 NM:i:0

ERR035488.889173        147     chr1    24870728        99      72M     =       24870687        -113    TCATTTTGTTTTGAGAAGTAGCAAAATTGTTTTTTCTACTAATTAGCCAGTTACTCTGAGATAAAAGTCACG       <@<?@BCFFEGFHFHHIICIHEFHHGGFGGFGGGCGC?GCGFFCIGGHGHFC@G@GEGHGECFFEGE?D::?        PQ:i:49 SM:i:96 UQ:i:0  MQ:i:96 XQ:i:34 NM:i:0

What can I do to solve this problem?



cigar sequence length samtools • 5.6k views
Entering edit mode

You say the script crashed, but still gave a SAM file? Did you look at the tail of the SAM file to see if it is truncated? if it is, you can get rid of the truncated line and convert what's left to BAM.

Entering edit mode

There seems to be no inconsistency with the CIGAR string and read length. I'd first check seidel's suggestion.

Entering edit mode

Base quality string looks incorrect for first read (length inconsistency). Don't know if it's the reason why aligner is crashing.

Entering edit mode

Ashwin, are you sure you accounted for the HTML in the quality?

Entering edit mode

this is a Biostar display error, the rendering protection thinks that some of the content in the quality may be an HTML tag and is therefore escaped as [HTML]

Entering edit mode

Think there should be a way to post plain texts in posts without any html-or any extra validation.

Entering edit mode

Either way the quality string looks incorrect.


Login before adding your answer.

Traffic: 856 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6