Confusion about trimmomatic
0
0
Entering edit mode
4 months ago
szahid • 0

Hi All,

I'm new to bioinformatics and currently working on some rna seq data. I'm using trimmomatic to remove adaptor contamination.

I'm using the following script and I get the following message. It's been like this for an hour, how do I make sure its even working and not just stuck?

]$ java -jar /gscratch/stf/szahid/Trimmomatic-0.39/trimmomatic-0.39.jar PE -phred33 /gscratch/stf/szahid/VD03_R1_001.fastq.gz /gscratch/stf/szahid/VD03_R2_001.fastq.gz VD03_R1_001.paired.fastq.gz VD03_R1_001.unpaired.fastq.gz VD03_R2_001.paired.fastq.gz VD03_R2_001.unpaired.fastq.gz ILLUMINACLIP:/gscratch/stf/szahid/Trimmomatic-0.39/adapters/TruSeq3-PE.fa/:2:30:10 LEADING:5 TRAILING:5 SLIDINGWINDOW:4:15 MINLEN:36 -trimlog VD03.log

TrimmomaticPE: Started with arguments:

 -phred33 /gscratch/stf/szahid/VD03_R1_001.fastq.gz /gscratch/stf/szahid/VD03_R2_001.fastq.gz VD03_R1_001.paired.fastq.gz VD03_R1_001.unpaired.fastq.gz VD03_R2_001.paired.fastq.gz VD03_R2_001.unpaired.fastq.gz ILLUMINACLIP:/gscratch/stf/szahid/Trimmomatic-0.39/adapters/TruSeq3-PE.fa/:2:30:10 LEADING:5 TRAILING:5 SLIDINGWINDOW:4:15 MINLEN:36 -trimlog VD03.log

Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'

ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences

Any help would be appreciated thanks!

RNA-Seq • 201 views
ADD COMMENT

Login before adding your answer.

Traffic: 1815 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6