Error in sequence length distribution

Question

[bioinformatics.queries]

Hello everyone,

I have question regarding the sequence length distribution. I used cutadapt tool to trim the adapter from paired sequence using the following command below:

cutadapt    -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC   -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT   -j 6 -o filter/R-2T1_R1_001.filter.fastq.gz -p filter/R-2T1_R2_001.filter.fastq.gz   R-2T1_R1_001.fastq.gz  R-2T1_R2_001.fastq.gz

However after the adapter removal it showed error in sequence length distribution. There was no error prior to adapter removal. I shall be highly appreciate if you can give suggestion how to overcome.

Thank you so much

[Ram]

A couple of points:

1. This should be a Question-type post, not a Tool-type post. The latter is used to introduce new tools, while the former covers all questions about existing tools.
2. Please see How to add images to a Biostars post to add your images properly - we recommend imgbb as an image hosting service, as it seems to work all over the world and doesn't need a user account to be created.
3. Please use the formatting bar (especially the code option) to present your post better. You can use backticks for inline code (`text` becomes text), or select a chunk of text and use the highlighted button to format it as a code block. I've done it for you this time.
   

[ATpoint]

I made the changes now, bioinformatics.queries please stop editing the post. For the future (not in this post anymore) please apply what _r_am listed.

Answer 1

[ATpoint]

If after trimming a fraction of reads is shorter than the bulk (which is expected) then this warning/error gets triggered. You can probably ignore it. Proceed with downstream analyis, fastqc (as good as it is) is a very basic QC tool and most warnings can be ignored or are not critical. Only thing I really look at are adapter contamination and per-base quality to see whether there is a general error//failure in the sequencing run. I would then only come back to it and look at the other metrics if something odd happens during downstream analysis which one needs to chase down.

[bioinformatics.queries]

Thanks for your response. But it doesn't show warning rather it shows error in the sequence length distribution. Is it still required to ignore it ? Could you please also suggest as to how to check fraction of reads is shorter than the bulk?

[ATpoint]

Yep. Warning/error is basically the same, the tool has some internal threshold when it triggers error or warning. I would just go on with analysis in your case.

[bioinformatics.queries]

Ok, I just have one last question, I see 40% duplicated sequences. Is it required to remove the duplicated sequences once the alignment is done in RNA-seq dataset?