Question: How to trim reads when I'm not sure where they are?
0
gravatar for avelarbio46
13 days ago by
avelarbio4610
avelarbio4610 wrote:

Hello everyone!

We did a RNAseq paired end with 150 bp in NovaSeq with TruSeq Total RNA strandred, with an external supplier. I'm now trying to analyze the data but I'm having trouble with the adaptors

They sent me the following sequences:

"

P7: GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCAGATTATCTCGTATGCCGTCTTCTGCTTG

P5: AGATCGGAAGAGCGTCGTGTAGGGAAAGA

"

But I'm not entirely sure how I should use this in cutadapt

With the manual of illumina (https://support.illumina.com/bulletins/2016/04/adapter-trimming-why-are-adapter-sequences-trimmed-from-only-the--ends-of-reads.html), I should remove both of them in the 3', but I'm not sure if p7 is for read 1 and p5 is for read 2, if I should remove both adapters from both ends of read 1 and 2 etc.

Maybe I should ask them, but I want to be sure what I need to ask so I can obtain the correct answer

Also, is it bad to remove both sequences from both ends of the 2 reads? Why?

cutadapt rna-seq illumina • 85 views
ADD COMMENTlink modified 13 days ago by shelkmike320 • written 13 days ago by avelarbio4610
1
gravatar for GenoMax
13 days ago by
GenoMax95k
United States
GenoMax95k wrote:

In illumina reads you should only see adapter sequence at the 3'-end of the reads. This will happen if you have short inserts and sequencing reads through those.

Would like to point out an easy alternative to cutadapt. You can use bbduk.sh from BBmap suite for the same purpose. A guide is available here. Program comes with a comprehensive set of adapter sequences for most commercial kits that you will find in the resources directory of the download.

ADD COMMENTlink modified 13 days ago • written 13 days ago by GenoMax95k
1
gravatar for shelkmike
13 days ago by
shelkmike320
Russian Federation
shelkmike320 wrote:

I recommend to use fastp. It is able to automatically guess adapter sequences in your reads and trim them, you don't even have have to know which adapters are in your reads.

ADD COMMENTlink modified 13 days ago • written 13 days ago by shelkmike320
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2529 users visited in the last hour
_