something about mirDeep2 error

0

Entering edit mode

3.1 years ago

972050141 • 0

I have some problem about the mirdeep2 but i don't know which step I was wrong. Can you tell me what is the problem about my sequence. Think you!

#Starting miRDeep2
/home/manager/miniconda3/bin/miRDeep2.pl 5223.fa mt.fna 5223.arf none none none

miRDeep2 started at 8:49:28

mkdir mirdeep_runs/run_27_02_2021_t_08_49_28

#testing input files
sanity_check_reads_ready_file.pl 5223.fa

started: 8:49:31
[1;31mError: [0mproblem with 5223.fa
Error in line 1.918.124: Either the sequence

ACGGTCTTACGTAGGACAACCGATGACGCTTq_11687569_x1
contains less than 17 characters or contains characters others than [acgtunACGTUN]

Please make sure that your file only comprises sequences that have at least 17 characters

containing letters [acgtunACGTUN]

software error • 568 views

ADD COMMENT • link updated 3.1 years ago by ATpoint 81k • written 3.1 years ago by 972050141 • 0

0

Entering edit mode

ACGGTCTTACGTAGGACAACCGATGACGCTTq_11687569_x1 contains less than 17 characters or contains characters others than [acgtunACGTUN]

The input file seems corrupted, mixing a header and a sequence.

ADD REPLY • link 3.1 years ago by ATpoint 81k

Login before adding your answer.