Malformed BAM while running GATK
0
0
Entering edit mode
10 weeks ago

Hi Guys,

While running GATK, I am getting ERROR MESSAGE: SAM/BAM/CRAM file bwa/aln-SRR13785703.bam is malformed. Please see https://software.broadinstitute.org/gatk/documentation/article?id=1317for more information. Error details: SAM file doesn't have any read groups defined in the header. The GATK no longer supports SAM files without read groups

So, there is a need to add read groups using picard tool (AddOrReplaceReadGroups) but for that I need parameters like RGID, RGLB, RGPL and RGPU. The sequencing platform I know, but how to get information regarding sequence library and barcode. I checked fastq header but there is no such information. The data has been fetched from SRA (SRR13785703). Please help me in this regard.

My fastq header is like: head SRR13785703_1.fastq

@SRR13785703.1 1 length=101 TNGCTGTGTCACACATTAAGCCAGGGGACTTTGCACCTCATTGCCTGGGGTCGGTTGGGGAGCTCCAGCTGCTCTGCCTGTTACTTTCCGGCCAGAGCCCA +SRR13785703.1 1 length=101 F#FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF @SRR13785703.2 2 length=101 TNGACCTGTGTGGGTCCGTCTTGGGGTTCCCTCGTTGAACATGCTGTCAAACCAGGACACTGGCTCCAGCTTGTGTTTCTGCTCTTGGCCATCGTCTGGGA +SRR13785703.2 2 length=101 F#FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF @SRR13785703.3 3 length=101 GNCCGCCGCTGGCCCTGTGCGAGCACCTCGTCCGGCCAGGCGTCCCGCAGCTGCTGCAGCCGCGCTCGCGCCGCCTCCAGCTCCGCGAGCTGCTCGCGCTC

GATK BAM Read group Barcode • 122 views
ADD COMMENT
0
Entering edit mode

the error is quite clear and is unrelated to your reads

SAM file doesn't have any read groups defined in the header. The GATK no longer supports SAM files without read groups

GATK, SAM file doesn't have any read groups defined in the header

GATK: SAM file doesn't have any read groups defined in the header.

ADD REPLY

Login before adding your answer.

Traffic: 2358 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6