Alignment Report: Match Without Referece

Question

[beibeichen1103]

Hi,

I used novoalign to map some sequence and got this kind of result in SAM format:

SRR2002    0    *    175710298    0    23M13H    *    0    0    CAATTGTCAGAGGTGAAATTCTT    B>7<?99@:9<=:;569=>B@=@    PG:Z:novoalign    AS:i:55    UQ:i:55    NM:i:2    MD:Z:15G0C6

It is mapped to the genome, with the match start, strand, even the mismatches are reported. However, the third column, where should be "chrN" turned out to be a star.

Any one encountered this situation? Could any body kindly tell me why this happened?

Thanks in advance!

Answer 1

[Rm]

Go through the "RNAME" of the SAM format (http://samtools.sourceforge.net/SAM1.pdf):

"3. RNAME: Reference sequence NAME of the alignment. If @SQ header lines are present, RNAME (if not '*') must be present in one of the SQ-SN tag. An unmapped segment without coordinate has a '*' at this eld. However, an unmapped segment may also have an ordinary coordinate such that it can be placed at a desired position after sorting. If RNAME is '*', no assumptions can be made about POS and CIGAR."