Question: Working With Fastq Files In Gmap
0
gravatar for Assa Yeroslaviz
6.5 years ago by
Assa Yeroslaviz1.2k
Munich
Assa Yeroslaviz1.2k wrote:

Hi,

I am trying to work with the gmap/gsnap tools. I have fastq files and wanted to ask whether it make sense at all to try and convert the reads into fastA format so that I can work with the gmap tool.

I think, gmap work only with fastA but not with fastq, while gsnap can work with both.

I converted the fastq to fastA which looks like that:

>HWI-ST863:138:D0WT7ACXX:5:1101:1179:1941 1:N:0:GCCAAT
ACTTACAGCATCCTCTCATCTGGGTTAACTTACTCTTGGAGGAGATGAAGGTCACTGTGCCTGGCTATCAAACCTTCCATGCTGCTCCACAGAGACAAAGA
>HWI-ST863:138:D0WT7ACXX:5:1101:1577:1894 1:N:0:GCCAAT
NTGTGAGTATGTGTGTTGTGAGAGAGAGTATGTTTGTGTGTGTGAATGTGTGTGTCTCTGTGAGTGTGTGTGTGTGAGAGTATGTTTGTGTGTGTGTGAAT
>HWI-ST863:138:D0WT7ACXX:5:1101:1718:1912 1:N:0:GCCAAT
CTGCCTCTTCACATCTCAAAAGGTGATTAACATCCGGAGATTTACATCATCTGCCAAGTCCTGCTGATCAAACAGCAGGGTAAGTATGGAGAAGGGCCACA
...

I created the indexed files with my fastA DNA file. It worked good, but when I am running the gmap, it gives me always the error message "no paths found"

and the files resulted is .nomapping .fa, which looks like that:

>HWI-ST863:138:D0WT7ACXX:5:1101:1403:1981 1:N:0:AGTCAA
 Paths (0):

 >HWI-ST863:138:D0WT7ACXX:5:1101:1470:1997 1:N:0:AGTCAA
  Paths (0):

 >HWI-ST863:138:D0WT7ACXX:5:1101:1677:1894 1:N:0:AGTCAA
 Paths (0):
 ...

Is there an explanation for this behavior? Is it possible to use this fastq-converted fastA files to run gmap?

Thanks for the help, Assa

fasta fastq • 2.8k views
ADD COMMENTlink written 6.5 years ago by Assa Yeroslaviz1.2k

Just out of curiosity, why do you want to avoid using gsnap?

ADD REPLYlink written 6.5 years ago by Sean Davis25k

Could you supply the gmap command line?

ADD REPLYlink written 6.5 years ago by Sean Davis25k

I am searching for large indels in the genome of my mutated mice. I wanted to try and map them to the genome to see if I can detect any large insertions/deletion with gmap or gsnap.

I don't want to avoid gsnap, I just wanted t see the differences between the mapping of the two software. I think, if it is possible to map the fatsq file to the genome, it will be easier to observe the deletions.

my gmap command is:

gmap -D gmap_index/MT_mouse -d MT_mouse --split-output= G -j 64 --fails-as-input G_R2.fa

any ideas?

ADD REPLYlink modified 6.5 years ago by Istvan Albert ♦♦ 79k • written 6.5 years ago by Assa Yeroslaviz1.2k

what about using another mapping tool, such as blat.

ADD REPLYlink written 3.9 years ago by pengchy410
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 939 users visited in the last hour