Searching Repeats And Palindromic Sequences In Dna Sequences
4
4
Entering edit mode
11.4 years ago
Pappu ★ 2.1k

I have many DNA sequences with ~500-1250 bp each. I want to find out possible repeats and palindromics sequences upto length 12 in these sequences. I have tried several web servers without any avail. Here is an example of DNA sequence:

TGTCAGCTACCTTGATGGATTGAGTTTGTTTCGGTCGATGCTCCATCGGGAGAGAGTCTG
CGTCCTGGTCCGAGCAAGTCCCACCAAGTGGCACTTGGCGGCGCCATGTCCTATCTAGTG
CCACCATGTCCGAGGACTTTGATGGCACATGGTGGCACTTGATTTGCCCAAGTCCCACCT
GCTCCGACGTGGACCGACTTCGTGGCACATCGCTATCACCCACTCTACCGTTGAAAAGCC
GAAGTCAAGCGCCGAAAGCTGATCGATTTGCGGTGTGATACGTTGCCAGTGATTCGTTCC
GTGGTTTATGCTTGGCGCACCTACCGCGTCCCCGACGCATCGACTCCGCCGCCATTGCGC
GGCACAAAACGGCCTTCGATCCTTCCGTACGGAGGGGTACTGCAGGGCTCACTGTTCATG
CCGGAAATTGCACCGGCTTTTTTTTCAATCAAATCAAGTGGACCGTGTCGGATAGTGAGG
ACACCGGACACCGCGATACCAAGCCGATTGGCGGTCTGTTTGTGAAAATAGACCGTAGTG
CGGACAATTCCGAAGCCGGACACCGGACAGGTGCTCTGTGGAAATTCCGCGTATGCCCGA
CACCCTTACAGCCGCGTGGCTGGGTGCGGATCACGAAGCCCAAAACACTGCGGCGGGGAT
GATCTGACTTTGGGGTGGGGAGCTGCTTTGCGTGCCGAATGACGGCGAACGCAGGCTTCT
GAGCAAATATCGATCCGGGGGGCGCCACCGGTACCAGAACGGCGCAACAGGTAATCACCC
ATCACGGCAAGGGCCGCAGGCGTGTGGACGCAATCCACGCGAAGGCAGGCTCGCATCCAG
AGATGCACCGGATAGGGTGGCCGCGCAAGCGGTGCGTGAGGCGAGAGCCTTGCATGTTCG
CGAAGCGGACGGTCACGACGCATTGCTTCCATGCTCAGGGCCGATCGGTTTGGCATCGCT
AAAGGACCGGAAGAGTGGTTGTAGGACCGGCAGGGTGGGCCGGCAAGCTGGGGGTGGTAC
CCCGGTGCACCAAGCGGGCAGGGCCAATTCGGGGTTGGCGCCGCCGAGAATTGGGTTGCG
CAGATTTGCGCGGCCGGCGGGATGCGCTTAGCGCGAATAGGAATCCGTC
python • 25k views
ADD COMMENT
5
Entering edit mode
10.8 years ago
Hamish ★ 3.2k

The European Molecular Biology Open Software Suite (EMBOSS) includes some basic tools for finding tandem repeats and inverted repeats (see B.6.22. Applications in group Nucleic:repeats). There are many on-line services providing the EMBOSS tools, for example:

For more sophisticated repeat finding you will want to look at tools using Repbase for example:

Other nucleotide repeat finding methods found by a couple of web searches:

ADD COMMENT
4
Entering edit mode
11.4 years ago

Try to see what MUMmer can do for you. Also, this can be done with scan_for_matches.

ADD COMMENT
0
Entering edit mode
10.8 years ago

Have you tried searching for palindromes on biophp.org?

For repeats, I usually try Tandem Repeats Finder but it doesn't find any in your sequence. SelfBlast might be a good option if you are also looking for inverted repeats.

ADD COMMENT
0
Entering edit mode
10.8 years ago
Anima Mundi ★ 2.9k

Emboss Palindrome allows you to find palindromes with a minimum and a maximum length.

ADD COMMENT

Login before adding your answer.

Traffic: 2219 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6