Question: Trimming Adapters For Paired-End Sequences
3
gravatar for deepthithomaskannan
6.5 years ago by
Canada
deepthithomaskannan260 wrote:

Hi all,

I got illumina paired end fastq files. They told me to trim read 2 at the beginning for ~20 to 30 bp due to the WGA adapters.

Can we find the adapters by looking in to the quality? Which tool is good for trimming adapters by keeping the paired nature of the sequences? Is there any issues will come if I use bowtie2 in the downstream for aligning the trimmed sequences(trimming only one in pair) with ref?

Following is the example of read2:

@HWI-ST1162:139:C0H7WACXX:5:1101:1865:1112 2:N:0:CGATGTA GTCATGGTGTCTCTTCACAACAATGGAAACCCTAACTAAGACAAAGACTAATAGAAGTGTTTTTTTAGGAA

+

<9;>;>?1=>;=9=?########################################################

Thanks, Deepthi

ADD COMMENTlink modified 5.6 years ago by Hongshan40 • written 6.5 years ago by deepthithomaskannan260
1

Cutadapt Or Fastx Clipper

ADD REPLYlink written 6.5 years ago by Jeremy Leipzig18k
3
gravatar for Ashutosh Pandey
6.5 years ago by
Philadelphia
Ashutosh Pandey11k wrote:

This is sth that has been asked many times here and on other forums. I think you should just search smartly and u shud be able to find the solution. BTW, here is a page (http://intron.ccam.uchc.edu/groups/tgcore/wiki/013c0/Solexa_Library_Primer_Sequences.html) that lists standard adapters used by Illumina sequencing machine. I am sure there are tools like FastQC that can tell you about the overrepresented sequences in your reads. That may help too. For adapter trimming I use ea-utils fastqc tool that is much better than most of the adaptor trimming tool. I am sure there are some that are better than ea-utils but I prefer using ea-utils.

ADD COMMENTlink written 6.5 years ago by Ashutosh Pandey11k

Thank you ashutoshmits. I think this is a good solution.

ADD REPLYlink written 6.5 years ago by deepthithomaskannan260
3
gravatar for samsara
6.5 years ago by
samsara580
The Earth
samsara580 wrote:

I had encountered problem with Cutadapt and nowadays using trimgalore. Cutadapt did not remove both read mates based on quality after trimming in my case; I dont know why. Then later I had problem in downstream analysis. I did not encounter this problem in Trimgalore as it removes both mates based on quality.

READ1=r1.fastq
READ2=r2.fastq
$TRIMGALOREPATH --paired --fastqc_args "--outdir fastQC/outputDir/" -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT $READ1 $READ2

Here, adapter for forward read is - AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC adapter for reverse read is - AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

ADD COMMENTlink written 6.5 years ago by samsara580

Hi samsara;

first of all i would say thanks for your comment...

I am new in RNA-seq ... i have data Illumina hi-seq 2000, i used the fastqc to check quality so i found that there are overrepresented sequence in it.

read1:-GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC

read2:-GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG

so i tried to trim those sequnces based on your comment above..

i want to know whether its right which i did OR i should remove just 14bp of sequence taken as default in trimgalore software??

 

ADD REPLYlink written 4.4 years ago by nikhilvgbt0
2
gravatar for Hongshan
5.6 years ago by
Hongshan40
Hongshan40 wrote:

you may use skewer which is dedicated to trimming adapters for paired-end reads

URL: https://sourceforge.net/projects/skewer/files/Binaries/

Citation: BMC Bioinformatics.2014, 15:182

http://www.biomedcentral.com/1471-2105/15/182

ADD COMMENTlink modified 5.1 years ago • written 5.6 years ago by Hongshan40
1
gravatar for Jordan
6.5 years ago by
Jordan1.1k
Pittsburgh
Jordan1.1k wrote:

If you know the adapter sequence, you can use a tool called cutadapt to trim the adapter sequences in high-throughput data. But I'm not sure how bowtie2 works.

cutadapt -a ATCGACT file.fastq > output.fastq

Here, ATCGACT is the adapter sequence.

The documentation can be found here: cutadapt

ADD COMMENTlink modified 6.5 years ago • written 6.5 years ago by Jordan1.1k

I have no idea about adapter sequence. Then what are my options?

ADD REPLYlink written 6.5 years ago by deepthithomaskannan260

If you do not know the adapter sequence, I would go with the solution given by ashutoshmits as well.

ADD REPLYlink written 6.5 years ago by Jordan1.1k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 914 users visited in the last hour