Represent Precise Deletion In Vcf
3
2
Entering edit mode
8.7 years ago

Hi, in my master thesis I have to implement tool for detecting genome variations. Now, I am learning how to represent structural variations in VCF file. But after reading example in http://www.1000genomes.org/wiki/Analysis/Variant%20Call%20Format/vcf-variant-call-format-version-41 I am little bit confused.

Example says:

#CHROM  POS ID REF ALT QUAL FILTER INFO FORMAT NA00001
1 2827693 . CCGTGGATGCGGGGACCCGCATCCCCTCTCCCTTCACAGCTGAGTGACCCACATCCCCTCTCCCCTCGCA C . PASS SVTYPE=DEL;END=2827680;BKPTID=Pindel_LCS_D1099159;HOMLEN=1;HOMSEQ=C;SVLEN=-66 GT:GQ 1/1:13.9

Length of reference sequence is 70bp (69bp if we remove first base which doesn't belong to deletion), but SVLEN here is 66bp and also if we subtract END with POS, we get -13. Shouldn't SVLEN be 69 and END position 2827762? Or maybe I'm missing someting here.

Thanks for clarifying me this.

vcf 1000genomes • 3.6k views
ADD COMMENT
1
Entering edit mode

Congratulations on having the same master thesis project as me! :-)

ADD REPLY
3
Entering edit mode
8.7 years ago
bhandsaker ▴ 40

Yes, I think this is definitely buggy. I believe this record is supposed to represent rs2376870 (1000 Genomes ID P1M0615101909), which on hg18 should look like:

1 2827694 P1_M_061510_1_909 CGTGGATGCGGGGACCCGCATCCCCTCTCCCTTCACAGCTGAGTGACCCACATCCCCTCTCCCCTCGCA C . . BKPTID=Pindel_LCS_D1099159;END=2827762;HOMLEN=1;HOMSEQ=G;SVLEN=-68;SVTYPE=DEL

I amended the spec, versions 4.1 and 4.2 (draft). I also fixed the typo on the next line where SVLEN should have been -205, not -105.

ADD COMMENT
0
Entering edit mode

Can we move the docs to a public wiki?

ADD REPLY
2
Entering edit mode
8.7 years ago

SVLEN is defined as length(alt) - length(ref), so looks to me like it should be 69, and that is a typo.

ADD COMMENT
1
Entering edit mode
8.7 years ago
Adam ★ 1.0k

Probably best to ask on the vcf specification mailing list (vcftools-spec@lists.sourceforge.net), but I agree that it's probably a typo.

ADD COMMENT

Login before adding your answer.

Traffic: 2271 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6