Short-Read Assembly No Reference Sequence
2
0
Entering edit mode
8.8 years ago
2011101101 ▴ 110

I have small rna data to assembly,there is no reference sequence .the length is18-28nt.

The result like the result of cap3 . Like this

>1
ACCTTTTTTTTTTACCCCT
>2
CTTTTTTTTTTACCCCTACAC

Result

>contig1  
ACCTTTTTTTTTTACCCCTACAC

which program is better?

assembly • 1.8k views
ADD COMMENT
2
Entering edit mode

You will have to improve this question to get an answer. "Which soft is better" does not make sense. What is "soft"?

ADD REPLY
0
Entering edit mode

your reads are shorter than 28nt?

ADD REPLY
0
Entering edit mode

reads from short rna libraries often contain a very high percentage of adapter sequence, so in case you were running 36bp protocol it's not surprising to end up with 18-28bp soft-trimmed reads

ADD REPLY
0
Entering edit mode

Yes,the clean reads.

ADD REPLY
1
Entering edit mode
8.8 years ago
Andreas ★ 2.5k

You might want to start by having a look at this pretty exhaustive comparison, which is based on Fonseca et al. (2012) but up-to-date.

Andreas

ADD COMMENT
0
Entering edit mode

He says he has no reference genome and your second link points to a paper comparing mapping tools that require a reference. The first link seems to be broken.

ADD REPLY
0
Entering edit mode
8.8 years ago

One possibility is to do de novo assembly of your very short reads with Pinball:
https://github.com/avilella/pinball/wiki

If you want to skip installation and set up, you can try the virtual machine here:
ftp://ftp.ebi.ac.uk/pub/databases/ensembl/avilella/pinball/PinballVM.1.0.4.ova
The installation procedure of the virtual machine is the same as described here:
http://www.ensembl.org/info/data/virtual_machine.html

Hope it helps.

ADD COMMENT

Login before adding your answer.

Traffic: 1375 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6