Question: Mapping One Repeat (37Pb) With Bwa/Maq
gravatar for Pierre Lindenbaum
6.3 years ago by
Pierre Lindenbaum83k wrote:

Hi all, I'm playing with MAQ/BWA and I'm trying to map the following short read on chr22/hg19:


it should match twice at

 22   +   22678160  22678196
 22   +   22759880  22759916

when I use GWA , the read is mapped at 51304531 (?? 51304531+37 = length(chr22) ???)

bwa aln -N chr22.fa chr22.sai repeat.fastq > chr22.sai
bwa  samse chr22.fa chr22.sai repeat.fastq
@SQ    SN:Chr22    LN:51304566
repeat_1    4    Chr22    51304531    0    37M    *    0    0    GGTGTCTGGGACCAGAAAATAGTGAGGACCCTCTTAC    zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz    XT:A:N    NM:i:27    XN:i:36X0:i:4    X1:i:0    XM:i:0    XO:i:0    XG:i:0    MD:Z:2A0T0C2A0T0C0C0T1G1G0C0C0T1C0C0A0C0C2T0T1G0C0A0A0C0T0A0

when I use MAQ, only one position was reported.

I'm sure I'm missing something here, help ! :-)

Many thanks, pierre

next-gen mapping bwa sequencing • 2.1k views
ADD COMMENTlink modified 5.5 years ago by Brad Chapman8.9k • written 6.3 years ago by Pierre Lindenbaum83k

I compiled BWA for linux 32 bit (default is 64) . May be it's the source of the problem ?...

ADD REPLYlink written 6.3 years ago by Pierre Lindenbaum83k
gravatar for Brad Chapman
6.3 years ago by
Brad Chapman8.9k
Boston, MA
Brad Chapman8.9k wrote:

Maq does not handle repeats, and will randomly report one of the mapped positions:

BWA has similar behavior by default, but the -R flag to aln will give you repeats:

Last time I checked, multiple hit reports are not in SAM format. For projects needing repeats, I normally use Bowtie:

For your question about the BWA output -- that SAM line indicates the read is unmapped. The easiest cue to pick up on is the 4 in the flag field. I'd expect it to give you one hit randomly assigned with either of those positions, so not sure why that is.

ADD COMMENTlink written 6.3 years ago by Brad Chapman8.9k

Thanks again Brad :-)

ADD REPLYlink written 6.3 years ago by Pierre Lindenbaum83k

hey what bowtie parameters do you use when mapping to repeat databases?

ADD REPLYlink written 6.3 years ago by Jeremy Leipzig16k

@jeremy you can tell bowtie to report all mappings with --all or you can give an upper limit with -k (the default for -k is 1, so you only get the best hit).

ADD REPLYlink written 6.3 years ago by brentp21k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 550 users visited in the last hour