Question: Pindel Version 0.2.4W, Feb 25 2013 -- Test -- Results Not Identical
1
gravatar for kevinabbey.at.ccib
6.6 years ago by
kevinabbey.at.ccib10 wrote:

Hi,

I've installed the most recent version of pindel but the tests do not seem to complete properly. Is there any chance that the test is broken or is my installation bad and in need of a fresh start, ie. re-download-reinstall....test.

I've pasted some of the output below. Any notes with be helpful.

Thank you, Kevin

Pindel version 0.2.4w, Feb 25 2013.

using: git clone git://github.com/genome/pindel.git

test]$ make functional-tests make -C SmallTest functional-tests make[1]: Entering directory `/g1/software/pindel/src/pindel/test/SmallTest' rm -rf ActualOutput mkdir -p ActualOutput /g1/software/pindel/src/pindel/src/pindel -T 16 -i sim1chrVs2.conf -f sim1chrVs2.fa -c ALL -o ActualOutput/sim1chrVs20305 > sim1chrVs20305.log /g1/software/pindel/src/pindel/src/pindel -T 16 -P pindel-config-file.txt -f hs_ref_chr20.fa -l -k -B 100 -u 0.05 -x 5 -c 20:0-1,500,000 -o ActualOutput/colowobd15 > colowobd15.log /g1/software/pindel/src/pindel/src/pindel -T 16 -p COLO-829_20-p_ok.txt -f hs_ref_chr20.fa -l -k -B 100 -u 0.05 -x 5 -b COLO-829.20.BreakDancer.sv -Q colo_bd_out.txt -c 20:0-1,500,000 -o ActualOutput/colousingbd15 > colousingbd15.log ./compare.sh

* TargetOutput/colowobd15_D 2013-04-22 13:01:16.653995068 -0400 --- ActualOutput/colowobd15_D 2013-04-22 17:23:32.058971666 -0400


* 3413,3419 ** TAATATGTTTGGGAAAGGTCACTCTCTCTCGCTCTC TTTTTTTTTTTTTTTTTTGAGACAGGGTCTGTTCTGTCG - 927983 60 COLO-829-BL @@HWUSI-EAS493_8289_FC30GNW_PE:2:11:513:1563/1 GTCTCTGATGTGTAATATGTTTGGGAAAGGTCACTCTCCCTCGCTCTC TTTTTTTTTTTTTTTTTTGAGACAGGG - 927980 60 COLO-829 @@EAS188_62:1:99:910:55/2 #################################################################################################### ! 209 D 1 NT 0 "" ChrID 20 BP 937431 937433 BP_range 937431 937444 Supports 51 44 + 24 20 - 27 24 S1 700 SUM_MS 2945 2 NumSupSamples 2 2 COLO-829 0 0 17 14 16 13 COLO-829-BL 0 0 7 6 11 11 TGGAGGCAGAGGTTGCAGTGAGCCAAGATCGTGCCATTGCACTCCAGTCTGGGTGACAAGAGCAAGACTCCTCTCaAAAAAAAAAAATAAATAAATAATTGCAAGGGTTCCAACAAGTTTACTGTCATTGGACCTAAAGCCCACAAAAGT AAGACTCCTCTC AAAAAAATAAATANAGAAATAATTGCAAGGGTTCCAACAAGTTTACTGTCATTGGACCTAAAG - 937633 37 COLO-829-BL @@HWI-EAS107_8284_FC30GCE_PE:4:96:219:305/2 GCAAGACTCCTCTC AAAAAAATAAATAAATAAATAATTGCAAGGGTTCCAACAAGTTTACTGTCATTGGACCTAA + 937077 60 COLO-829 @@EAS192_60:3:57:135:1088/1 --- 3413,3419 ---- TAATATGTTTGGGAAAGGTCACTCTCTCTCGCTCTC TTTTTTTTTTTTTTTTTTGAGACAGGGTCTGTTCTGTCG - 927983 60 COLO-829-BL @@HWUSI-EAS493_8289_FC30GNW_PE:2:11:513:1563/1 GTCTCTGATGTGTAATATGTTTGGGAAAGGTCACTCTCCCTCGCTCTC TTTTTTTTTTTTTTTTTTGAGACAGGG - 927980 60 COLO-829 @@EAS188_62:1:99:910:55/2 #################################################################################################### ! 209 D 1 NT 0 "" ChrID 20 BP 937431 937433 BP_range 937431 937444 Supports 52 45 + 25 21 - 27 24 S1 728 SUM_MS 2982 2 NumSupSamples 2 2 COLO-829 0 0 18 15 16 13 COLO-829-BL 0 0 7 6 11 11 TGGAGGCAGAGGTTGCAGTGAGCCAAGATCGTGCCATTGCACTCCAGTCTGGGTGACAAGAGCAAGACTCCTCTCaAAAAAAAAAAATAAATAAATAATTGCAAGGGTTCCAACAAGTTTACTGTCATTGGACCTAAAGCCCACAAAAGT AAGACTCCTCTC AAAAAAATAAATANAGAAATAATTGCAAGGGTTCCAACAAGTTTACTGTCATTGGACCTAAAG - 937633 37 COLO-829-BL @@HWI-EAS107_8284_FC30GCE_PE:4:96:219:305/2 GCAAGACTCCTCTC AAAAAAATAAATAAATAAATAATTGCAAGGGTTCCAACAAGTTTACTGTCATTGGACCTAA + 937077 60 COLO-829 @@EAS192_60:3:57:135:1088/1


* 3451,3456 ** --- 3451,3457 ---- CCATTGCACTCCAGTCTGGGTGACAAGAGCAAGACTCCTCTC AAAAAAATAAATAAATAAATAATTGCAAGGGTT + 937235 60 COLO-829 @@EAS192_65:7:20:1558:1633/2 CCATTGCACTCCAGTCTGGGTGACAAGAGCAAGACTCCTCTC AAAAAAATAAATAAATAAATAATTGCAAGGGTT + 937238 60 COLO-829 @@EAS139_62:8:20:1171:1972/2 GCCATTGCACTCCAGTCTGGGTGACAAGAGCAAGACTCCTCTC AAAAAAATAAATAAATAAATAATTGCAAGGGT - 937805 60 COLO-829 @@EAS192_63:5:34:1535:1345/2 + GCCATTGCACTCCAGTCTGGGTGACAAGAGCAAGACTCCTCTC AAAAAAATAAATAAATAAATAATTGCAAGGGT + 936926 37 COLO-829 @@EAS192_60:3:29:1396:2028/1 GCCATTGCACTCCAGTCTGGGCGACAAGAGCAAGACTCCTCTC AAAAAAATAAATAAATAAATAATTGCAAGGGT - 937790 60 COLO-829 @@EAS139_64:6:13:1508:86/2 GCCATTGCACTCCAGTCTGGGTGACAAGAGCAAGACTCCTCTC AAAAAAATAAATAAATAAATAATTGCAAGGGT - 937606 60 COLO-829 @@EAS131_8:8:9:840:38/2 TGCCATTGCACTCCAGTCTGGGTGACAAGAGCAAGACTCCTCTC AAAAAAATAAATAAATAAATAATTGCAAGGG - 937595 60 COLO-829-BL @@HWUSI-EAS493_8289_FC30GNW_PE:5:10:910:759/1


Not identical make[1]: * [small-functional-test] Error 1 make[1]: Leaving directory `/g1/software/pindel/src/pindel/test/SmallTest' make: * [functional-tests] Error 2

error pindel • 2.3k views
ADD COMMENTlink modified 6.6 years ago by liangkaiye250 • written 6.6 years ago by kevinabbey.at.ccib10
1
gravatar for liangkaiye
6.6 years ago by
liangkaiye250
United States
liangkaiye250 wrote:

hi Kevin,

thanks for reporting this. we have the continuous integration implemented and had solved multiple problems like float point calculation. recently the automatic test was broken but we have not worked out a solution to fix, partly because I moved to US last year. we will get the test system implemented at WashU and then fix it.

Current error is caused by the difference between the results generated on the server and the local ubuntu workstation, even though the source code is the same.

Kai

ADD COMMENTlink written 6.6 years ago by liangkaiye250
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1153 users visited in the last hour