Adaptor Order In Pe Sequencing On Illumina Hiseq
1
0
Entering edit mode
9.4 years ago
Sakti ▴ 510

Dear all,

This might be a stupid question, but it's better asking than wasting a whole lane of HiSeq (and my PI hating me for the rest of my degree ).

I have different regions I'd like to amplify using PCR with primers that already have ligated Illumina PE adaptors to them, as in the following scheme:

Forward primer: [P1adaptor][forward.primer.sequence]
Reverse primer: [P2adaptor][reverse.primer.sequence]

Using one of my examples:

forward primer: [ATGAGGGTCCAATCCATAAGC]
reverse primer: {AGAGACATCGGTCTCTGATGGT}

With adaptors:

forward with P1: AATGATA...CGCTCTTCCGATCT[ATGAGGGTCCAATCCATAAGC]
reverse with P2: CAAGCAG...CTCTTCCGATCT{AGAGACATCGGTCTCTGATGGT}

So the PCR product would look something like:

*[P1adaptor][forward.primer.sequence]XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX[reverse.primer.sequence][P2adaptor]*

My question is, would it matter if I swap the order of adaptors so that instead of forward primer having PE1 adaptor it has PE2??

Like this:

Reverse primer: [P1adaptor][reverse.primer.sequence]
Forward primer: [P2adaptor][forward.primer.sequence]

And with the used examples:

forward with P2: CAAGCAG...CTCTTCCGATCT[ATGAGGGTCCAATCCATAAGC]
reverse with P1: AATGATA...CGCTCTTCCGATCT{AGAGACATCGGTCTCTGATGGT}

I think it shouldn't alter anything, just basically the order in which the primer sequence is reported (reverse primer now being reported in the 1st PE reads rather than the 2nd reads). But still,I want to know if that alters the PCR reaction itself (i.e. primers going outwards instead of ampiying into the region I want)

Thanks!!!

hiseq illumina sequencing adaptor • 3.3k views
ADD COMMENT
0
Entering edit mode

This is not really a bioinformatics question, more a molecular biology protocol. SEQanswers or a protocols forum might be a better place to ask.

ADD REPLY
1
Entering edit mode
9.4 years ago
Christof Winter ★ 1.0k

Swapping the adapter orders will merely swap read1 and read2 of your sequencing results.

primers going outwards instead of ampiying into the region I want

No, the primer has in inherent order -- polymerase always adds at the 3' end of the primer. So if your primer design is right, there is no way you could mess this up by attaching adapters to the 5' end of the primer.

ADD COMMENT

Login before adding your answer.

Traffic: 1013 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6