Question: How To Run Phrap With Quality Score Input
0
gravatar for Pdubois
7.9 years ago by
Pdubois30
Pdubois30 wrote:

I tried the following command:

./phrap/phrap.manyreads  Sample.fasta  Sample.qual -ace

But it failed:

phrap version 0.990329
FATAL ERROR: With current phrap version only one input sequence file may be specified

The Sample.fasta looked like this:

>chr17_4124679_4124041_1_0_1:0:1_3:0:0_0/1
ATTCTTCTAAACACTTTGGAGTATACGGTTGTGTGAATGTATTTAACCAGTTCTTCTTGAGGAACTTTGTGATTGT
>chr17_2975404_2976000_0_1_0:0:0_1:0:0_1/1
GATCACGCCATTTCATTTCAGCCTGGGTGAAAAAAGTAAAACTCTGTCTCAAAAAAAAATTTAAAAATTATAGTCA

and Sample.qual looked like this:

>chr17_4124679_4124041_1_0_1:0:1_3:0:0_0/1
37 36 40 39 19 20 40 26 40 40 40 40 40 40 40 40 34 40 34 40 40 40 40 6 40 18 13 23 22 15 9 10 11 36 40 34 15 3 17 9 23 20 19 30 22 26 36 22 20 10 12 9 7 3 5 10 0 40 18 7 3 20 4 7 10 10 3 5 8 10 10 6 4 1
>chr17_2975404_2976000_0_1_0:0:0_1:0:0_1/1
24 10 40 40 40 40 40 40 40 40 40 14 35 33 3 7 29 26 40 40 40 40 40 40 40 40 40 31 23 3 3 1 12 13 10 2 4 6 4 4 5 2 4 15 12 16 14 23 12 5 4 17 22 10 8 5 4 4 2 2 6 3 3 36 5 1 15 11 20 3 3 4 4 5 6 10

What's the right way to do it?

assembly quality • 1.8k views
ADD COMMENTlink written 7.9 years ago by Pdubois30
3
gravatar for Benm
7.9 years ago by
Benm30
Benm30 wrote:

Just named the quality file as the same as the the sequence file included ".fasta" or ".fa" or ".seq", and with the suffix of ".qual". Like this: Sample.seq Sample.seq.qual Then put them together in the same folder, and run: phrap.manyreads Sample.seq -new_ace > phrap.out

ADD COMMENTlink written 7.9 years ago by Benm30
1
gravatar for Daniel
7.9 years ago by
Daniel3.7k
Cardiff University
Daniel3.7k wrote:

I always find it easier to cat all my individual reads into one .fas file (and corresponding .qual) and read that in with phrap. Depends on the numbers you're working with obviously.

ADD COMMENTlink written 7.9 years ago by Daniel3.7k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1306 users visited in the last hour