Question: Is There Is Tool For Variable Tandem Repeats Finding?
2
gravatar for zeleniy.spb
6.5 years ago by
zeleniy.spb30
zeleniy.spb30 wrote:

For example i have the next sequnce:
ACGAGGTTACTACTACTAGTACTACGCC
As you can see there is a tandem repeat with monomer TAC. But because of mutation one monomer now is TAG and, for example, exact-tandems tool cannot recognise TACTACTACTAGTACTAC as one repeat. So how can i identify TACTACTACTAGTACTAC as one repeat, not two separeted by TAG sequnce?

• 3.2k views
ADD COMMENTlink modified 9 months ago by kashiff007100 • written 6.5 years ago by zeleniy.spb30
4
gravatar for JC
6.5 years ago by
JC9.1k
Mexico
JC9.1k wrote:

Try the old and still working Tandem Repeat Finder http://tandem.bu.edu/trf/trf.html

ADD COMMENTlink written 6.5 years ago by JC9.1k

The common reason to use TRF is that has been used by a lot of other researchers, and is well cited. However, benchmarks show that it lacks sensitivity, without being particularly specific. Thus, I'd recommend using other tools, or at least adding results from other tools.
 

ADD REPLYlink written 4.2 years ago by Elke Schaper60
2
gravatar for Medhat
6.5 years ago by
Medhat8.5k
Texas
Medhat8.5k wrote:

NTRFinder: a software tool to find nested tandem repeats

and here is a review Review of tandem repeat search tools: a systematic approach to evaluating algorithmic performance.

ADD COMMENTlink modified 6.5 years ago • written 6.5 years ago by Medhat8.5k
1
gravatar for Jordan
6.5 years ago by
Jordan1.1k
Pittsburgh
Jordan1.1k wrote:

Why don't you take a look at EMBOSS etandem? And here is the manual -> link

ADD COMMENTlink written 6.5 years ago by Jordan1.1k
1
gravatar for Elke Schaper
4.2 years ago by
Elke Schaper60
Switzerland
Elke Schaper60 wrote:

Quite a lot of reviews have been published on the topic. Have a look at e.g.

Detecting short tandem repeats from genome data: opening the software black box

Repeat or not repeat?- Statistical validation of tandem repeat prediction in genomic sequences

 

Among many more tools (>50), there is:

XSTREAM

T-REKS

Perhaps useful, we've implemented the Python3 library TRAL to allow among others easy running, parsing and merging of tandem repeat detection tools.

 

ADD COMMENTlink written 4.2 years ago by Elke Schaper60
0
gravatar for Sukhdeep Singh
9 months ago by
Sukhdeep Singh9.9k
Netherlands
Sukhdeep Singh9.9k wrote:

Also, check out MISA

Beier S, Thiel T, Münch T, Scholz U, Mascher M (2017) MISA-web: a web server for microsatellite prediction. Bioinformatics 33 2583–2585. dx.doi.org/10.1093/bioinformatics/btx198

ADD COMMENTlink written 9 months ago by Sukhdeep Singh9.9k
0
gravatar for kashiff007
9 months ago by
kashiff007100
Cologne
kashiff007100 wrote:

See also, MEME-suite (http://meme-suite.org/doc/meme-format.html). It's different tools by which you can discover new repeats (MEME), can look for repeat/motif enrichment in particular region of the genome (CentrMo), can scan your repeat/motif in the genome (FIMO) and many more related analysis.

ADD COMMENTlink written 9 months ago by kashiff007100
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2102 users visited in the last hour