Is There Is Tool For Variable Tandem Repeats Finding?

Question: Is There Is Tool For Variable Tandem Repeats Finding?

6.3 years ago by

zeleniy.spb • 30 wrote:

For example i have the next sequnce:
ACGAGGTTACTACTACTAGTACTACGCC
As you can see there is a tandem repeat with monomer TAC. But because of mutation one monomer now is TAG and, for example, exact-tandems tool cannot recognise TACTACTACTAGTACTAC as one repeat. So how can i identify TACTACTACTAGTACTAC as one repeat, not two separeted by TAG sequnce?

• 3.0k views

ADD COMMENT • link •

modified 6 months ago by kashiff007 • 70 • written 6.3 years ago by zeleniy.spb • 30

6.3 years ago by

JC ♦ 8.2k

Mexico

JC ♦ 8.2k wrote:

Try the old and still working Tandem Repeat Finder http://tandem.bu.edu/trf/trf.html

ADD COMMENT • link written 6.3 years ago by JC ♦ 8.2k

The common reason to use TRF is that has been used by a lot of other researchers, and is well cited. However, benchmarks show that it lacks sensitivity, without being particularly specific. Thus, I'd recommend using other tools, or at least adding results from other tools.

ADD REPLY • link written 4.0 years ago by Elke Schaper • 60

6.3 years ago by

Medhat ♦ 8.4k

Texas

Medhat ♦ 8.4k wrote:

NTRFinder: a software tool to find nested tandem repeats

and here is a review Review of tandem repeat search tools: a systematic approach to evaluating algorithmic performance.

ADD COMMENT • link modified 6.3 years ago • written 6.3 years ago by Medhat ♦ 8.4k

6.3 years ago by

Jordan • 1.1k

Pittsburgh

Jordan • 1.1k wrote:

Why don't you take a look at EMBOSS etandem? And here is the manual -> link

ADD COMMENT • link written 6.3 years ago by Jordan • 1.1k

4.0 years ago by

Elke Schaper • 60

Switzerland

Elke Schaper • 60 wrote:

Quite a lot of reviews have been published on the topic. Have a look at e.g.

Detecting short tandem repeats from genome data: opening the software black box

Repeat or not repeat?- Statistical validation of tandem repeat prediction in genomic sequences

Among many more tools (>50), there is:

XSTREAM

T-REKS

Perhaps useful, we've implemented the Python3 library TRAL to allow among others easy running, parsing and merging of tandem repeat detection tools.

ADD COMMENT • link written 4.0 years ago by Elke Schaper • 60

6 months ago by

Sukhdeep Singh ♦ 9.8k

Netherlands

Sukhdeep Singh ♦ 9.8k wrote:

Also, check out MISA

Beier S, Thiel T, Münch T, Scholz U, Mascher M (2017) MISA-web: a web server for microsatellite prediction. Bioinformatics 33 2583–2585. dx.doi.org/10.1093/bioinformatics/btx198

ADD COMMENT • link written 6 months ago by Sukhdeep Singh ♦ 9.8k

6 months ago by

kashiff007 • 70

Cologne

kashiff007 • 70 wrote:

See also, MEME-suite (http://meme-suite.org/doc/meme-format.html). It's different tools by which you can discover new repeats (MEME), can look for repeat/motif enrichment in particular region of the genome (CentrMo), can scan your repeat/motif in the genome (FIMO) and many more related analysis.

ADD COMMENT • link written 6 months ago by kashiff007 • 70

Please log in to add an answer.

Similar posts • Search »