Is There Is Tool For Variable Tandem Repeats Finding?
6
2
Entering edit mode
11.2 years ago
zeleniy.spb ▴ 30

For example I have the next sequence:

ACGAGGTTACTACTACTAGTACTACGCC
#      _________^^^______

As you can see there is a tandem repeat with monomer TAC. But because of mutation one monomer now is TAG and, for example, exact-tandems tool cannot recognise TACTACTACTAGTACTAC as one repeat. So how can I identify TACTACTACTAGTACTAC as one repeat, not two separated by TAG sequence?

tandem-repeats • 6.7k views
ADD COMMENT
4
Entering edit mode
11.2 years ago
JC 13k

Try the old and still working Tandem Repeat Finder http://tandem.bu.edu/trf/trf.html

ADD COMMENT
1
Entering edit mode

The common reason to use TRF is that has been used by a lot of other researchers, and is well cited. However, benchmarks show that it lacks sensitivity, without being particularly specific. Thus, I'd recommend using other tools, or at least adding results from other tools.

ADD REPLY
2
Entering edit mode
8.9 years ago
Elke Schaper ▴ 110

Quite a lot of reviews have been published on the topic. Have a look at e.g.

Detecting short tandem repeats from genome data: opening the software black box

Repeat or not repeat?- Statistical validation of tandem repeat prediction in genomic sequences

Among many more tools (>50), there is:

XSTREAM

T-REKS

Perhaps useful, we've implemented the Python3 library TRAL to allow among others easy running, parsing and merging of tandem repeat detection tools.

ADD COMMENT
2
Entering edit mode
5.4 years ago
kashiff007 ★ 1.9k

See also, MEME-suite (http://meme-suite.org/doc/meme-format.html). It's different tools by which you can discover new repeats (MEME), can look for repeat/motif enrichment in particular region of the genome (CentrMo), can scan your repeat/motif in the genome (FIMO) and many more related analysis.

ADD COMMENT
1
Entering edit mode
11.2 years ago
Jordan ★ 1.3k

Why don't you take a look at EMBOSS etandem? And here is the manual -> link

ADD COMMENT
0
Entering edit mode
5.4 years ago

Also, check out MISA

Beier S, Thiel T, Münch T, Scholz U, Mascher M (2017) MISA-web: a web server for microsatellite prediction. Bioinformatics 33 2583–2585. dx.doi.org/10.1093/bioinformatics/btx198

ADD COMMENT

Login before adding your answer.

Traffic: 3494 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6