Computing Dinucleotide Frequencies / Markov Models And Scoring Sequences In Python?
0
1
Entering edit mode
11.1 years ago
user ▴ 940

is there a library that provides simple features for learning/representing markov models on DNA/RNA sequences? for example given a long sequence, learn the matrix of dinucleotide frequencies from that sequence, and then answer questions like: what is the expected number of occurrences of a subsequence given that dinucleotide freq. matrix?

e.g. if you have:

s = ATGGGGTATTGGGTTAAAAGGGGTTATAGCCCGATGCGCGT

what is the expected number of occurrences of ATATG given the dinucleotide freq. matrix of s?

Is there a library that implements all of these simple markov-model related features? BioPython seems to have some HMM features but I was not able to find actual documentation or examples. thanks.

hmm sequence motif python biopython • 3.8k views
ADD COMMENT

Login before adding your answer.

Traffic: 2717 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6