Question: Mauvealigner Error
gravatar for HG
7.6 years ago by
HG1.1k wrote:

Dear All, I used MIRA for genome assembly and i got contigfile " Ecoli-1_out.unpadded.fasta". Now i want to do alignment with this contig with another Ecoli genome " refseq.fasta". In command line i am typinglike this and getting error message.

Attempt 1:
 ./mauveAligner --output=ec_ec.mauve --output-alignment=ec_vs_ec.alignment Ecoli-1_out.unpadded.fasta refseq.fasta 
Sequence loaded successfully.
Ecoli-1_out.unpadded.fasta 4982364 base pairs.
Using weight 15 mers for initial seeds
Creating sorted mer list
Create time was: 2 seconds.
91%..92%..93%..94%..95%..96%..97%..98%..99%..Starting with 0 MUMs
Eliminating overlaps yields 0 MUMs

 ./mauveAligner --output=jb50vsSpmito.mauve --output-alignment=jb50vsSpmito.alignment Ecoli-1_out.unpadded.fasta jb50contigs.fa.sslist refseq.fasta Sp.may2011.extras_mito.fasta.sslist
Sequence loaded successfully.
Ecoli-1_out.unpadded.fasta 4982364 base pairs.
Sequence loaded successfully.
refseq.fasta 2435000 base pairs.
Using weight 15 mers for initial seeds
Creating sorted mer list
Create time was: 2 seconds.
Creating sorted mer list
ERROR! gap character encountered at genome sequence position 61
Input sequences must be unaligned and ungapped!

Kindly help me out. Responses are highly appreciated!!!

ADD COMMENTlink modified 4.9 years ago by Biostar ♦♦ 20 • written 7.6 years ago by HG1.1k

Are there gap characters in your sequences?

ADD REPLYlink written 7.6 years ago by lelle830

Yes, have you checked for a gap at sequence position 61? Do you have a whitespace or a FASTA line return error? This sounds like an error in your first line of data.

ADD REPLYlink modified 7.6 years ago • written 7.6 years ago by Josh Herr5.7k

i dont think that there is a gap : i have pasted few header line of reference file as well as contig file .


Ecoli-1_c1 atcgtagtgacgtcaacgcaaggggaaggggaaccgccggaagaagccgtcgcgctgcat aagttcctgttctccaaaaaagcgccaaagctggaaaacaccgcgtttgccgtgtttagc ctcggcgatagctcttatgaatttttctgccagtccgggaaagatttcgacagcaagctg gcggaactgggtggtgaacgcctgctcgaccgtgtcgatgccgatgttgaataccaggct

Now i am following steps like and getting error : ./mauveAligner --output=ec_ec.mauve --output-alignment=ec_vs_ec.alignment Ecoli-1_out.unpadded.fasta Ecoli-1_out.unpadded.fasta.sml sequence..fasta sequence..fasta.sml Sequence loaded successfully. Ecoli-1_out.unpadded.fasta 4982364 base pairs. Exception FileNotOpened thrown from Unknown() in gnFileSource.cpp 67 Called by Unknown() Using weight 15 mers for initial seeds Sorted mer list loaded successfully 0%..1%..2%..3%..4%..5%..6%..7%..8%..9%..10%.. 11%..12%..13%..14%..15%..16%..17%..18%..19%..20%.. 21%..22%..23%..24%..25%..26%..27%..28%..29%..30%.. 31%..32%..33%..34%..35%..36%..37%..38%..39%..40%.. 41%..42%..43%..44%..45%..46%..47%..48%..49%..50%.. 51%..52%..53%..54%..55%..56%..57%..58%..59%..60%.. 61%..62%..63%..64%..65%..66%..67%..68%..69%..70%.. 71%..72%..73%..74%..75%..76%..77%..78%..79%..80%.. 81%..82%..83%..84%..85%..86%..87%..88%..89%..90%.. 91%..92%..93%..94%..95%..96%..97%..98%..99%..Starting with 0 MUMs Eliminating overlaps yields 0 MUMs

ADD REPLYlink written 7.6 years ago by HG1.1k

i dont think that there is a gap : i have pasted few header line of reference file as well as contig file .


Ecoli-1_c1 atcgtagtgacgtcaacgcaaggggaaggggaaccgccggaagaagccgtcgcgctgcat aagttcctgttctccaaaaaagcgccaaagctggaaaacaccgcgtttgccgtgtttagc ctcggcgatagctcttatgaatttttctgccagtccgggaaagatttcgacagcaagctg gcggaactgggtggtgaacgcctgctcgaccgtgtcgatgccgatgttgaataccaggct

Now i am following steps like and getting error : ./mauveAligner --output=ec_ec.mauve --output-alignment=ec_vs_ec.alignment Ecoli-1_out.unpadded.fasta Ecoli-1_out.unpadded.fasta.sml sequence..fasta sequence..fasta.sml Sequence loaded successfully. Ecoli-1_out.unpadded.fasta 4982364 base pairs. Exception FileNotOpened thrown from Unknown() in gnFileSource.cpp 67 Called by Unknown() Using weight 15 mers for initial seeds Sorted mer list loaded successfully 0%..1%..2%..3%..4%..5%..6%..7%..8%..9%..10%.. 11%..12%..13%..14%..15%..16%..17%..18%..19%..20%.. 21%..22%..23%..24%..25%..26%..27%..28%..29%..30%.. 31%..32%..33%..34%..35%..36%..37%..38%..39%..40%.. 41%..42%..43%..44%..45%..46%..47%..48%..49%..50%.. 51%..52%..53%..54%..55%..56%..57%..58%..59%..60%.. 61%..62%..63%..64%..65%..66%..67%..68%..69%..70%.. 71%..72%..73%..74%..75%..76%..77%..78%..79%..80%.. 81%..82%..83%..84%..85%..86%..87%..88%..89%..90%.. 91%..92%..93%..94%..95%..96%..97%..98%..99%..Starting with 0 MUMs Eliminating overlaps yields 0 MUMs

ADD REPLYlink written 7.6 years ago by HG1.1k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2403 users visited in the last hour