Question: (Closed) How To Create Dot-Bracket Annotation For Rna With Pseudoknots
1
gravatar for Niklas
7.4 years ago by
Niklas60
Niklas60 wrote:

Dear all,

I am trying to figure out a way of creating a Dot-Bracket structure for an RNA with arbitrary pseudoknots. The input data is a list of base pairs like this one:

5 17
6 16
7 15
10 20
11 19

The output should look like this:

....(((..[[...))).]]
AUGUACCGUCCUUUUGGAGG

Since there is no restriction on the pseudoknots there could also be a base pair 12 30 which would need a different set of brackets, e.g. { }.

Does anyone know an effective way of doing this? Any help would be appreciated!

Regards Nick

rna secondary • 2.7k views
ADD COMMENTlink modified 7.4 years ago • written 7.4 years ago by Niklas60

Closing as "no longer relevant", since you quickly answered your own question.

ADD REPLYlink written 7.4 years ago by Neilfws48k
1
gravatar for Niklas
7.4 years ago by
Niklas60
Niklas60 wrote:

Ok, I just solved it :-)

I create a stack for each kind of brackets I use and for each new base pair I check if it crosses any of the base pairs on one stack. If it doesn't I put it on this stack and use the corresponding brackets, if not I move on to the next stack.

I don't know if it's the most efficient way but it's sufficient.

ADD COMMENTlink written 7.4 years ago by Niklas60

Hey, Niklas can you please  help me with this post ??

Can Anyone Suggest Me A Program For Converting Dot-Bracket Notation Format To Standard Hybridization Format.

Thanks in advance.

ADD REPLYlink written 4.4 years ago by gauravdube0070
Please log in to add an answer.
The thread is closed. No new answers may be added.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 898 users visited in the last hour