Off topic:How To Create Dot-Bracket Annotation For Rna With Pseudoknots

Question

[Niklas]

Dear all,

I am trying to figure out a way of creating a Dot-Bracket structure for an RNA with arbitrary pseudoknots. The input data is a list of base pairs like this one:

5 17
6 16
7 15
10 20
11 19

The output should look like this:

....(((..[[...))).]]
AUGUACCGUCCUUUUGGAGG

Since there is no restriction on the pseudoknots there could also be a base pair 12 30 which would need a different set of brackets, e.g. { }.

Does anyone know an effective way of doing this? Any help would be appreciated!

Regards Nick