Question: Tophat Error: It Tries To Execute Lines In Fastq Files
0
gravatar for newDNASeqer
6.6 years ago by
newDNASeqer670
United States
newDNASeqer670 wrote:

From a previous RNASeq data that was analyzed a year ago, I tried to use the unmapped data and align it to a different species genome (mouse), and I used PiCard to convert the unmapped.bam file (generated by Tophat) to fastq format. Then I tried to run the following tophat command, but got the following error message:

> tophat -p 4 \
 --bowtie1 \
 -z 0 \
 --library-type fr-unstranded \
 --GTF illumina_mouse_37_1.gtf \
--read-mismatches   3 \
 --segment-mismatches 2 \
 --segment-length 25 \
 -o tophat_OUT \
 illumina_mouse_37_1 \
 fastq/file1.fastq.gz

-------------------------------------------------------------------------------
> [2013-07-30 13:06:28] Checking for Bowtie
          Bowtie version:     0.12.7.0
[2013-07-30 13:06:28] Checking for Samtools
        Samtools version:     0.1.18.0
[2013-07-30 13:06:28] Checking for Bowtie index files
[2013-07-30 13:06:28] Checking for reference FASTA file
[2013-07-30 13:06:28] Generating SAM header for /usr/local/bowtie_indicies/mouse_ncbi_37_2
Traceback (most recent call last):
  File "/usr/local/bin/tophat-2.0.6/tophat", line 4022, in <module>
    sys.exit(main())
  File "/usr/local/bin/tophat-2.0.6/tophat", line 3877, in main
    params.read_params = check_reads_format(params, reads_list)
  File "/usr/local/bin/tophat-2.0.6/tophat", line 1814, in check_reads_format
    zf = ZReader(f_name, params)
  File "/usr/local/bin/tophat-2.0.6/tophat", line 1767, in __init__
    self.file=open(filename)
IOError: [Errno 2] No such file or directory: ' '
./fastq/file1.fastq.gz: line 1: @HISEQ:64:C1VDJACXX:1:1101:1827:1944: command not found
./fastq/file1.fastq.gz: line 2: NGATCAAGTTGGATAGCAAGGGACCCGTCATTTACAAGCAAGAGCGCGTGACCCAGTACAACCGGCCGTTCAAGATTTGGAAGTTCCGTACTATGGTGAC: command not found
./fastq/file1.fastq.gz: line 3: +: command not found
./fastq/file1.fastq.gz: line 5: @HISEQ:64:C1VDJACXX:1:2215:2407:17672: command not found
./fastq/file1.fastq.gz: line 6: CTGAGATCTAAAGAGACATTTCCTCAATGCAAATCAGTTGATTCTTCAGCTCTTAGCTCCCTCCAGGTCCTAGGCCCAAACTTGGAAACTCCAAAGTCTA: command not found
./fastq/file1.fastq.gz: line 7: +: command not found
./fastq/file1.fastq.gz: line 8: syntax error near unexpected token `newline'
./fastq/file1.fastq.gz: line 8: `BBBFFFFFFFFFFIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIFIIIIIIIIIIIIIIIIIFFFIIIIIFIFFFFFFFFFFFFFFFFFBFBB<<'

why does tophat complain that those lines in fastq file are not commands? why does Tophat execute those lines in FastQ files? I don't understand, please help. thank you

tophat bowtie error • 2.8k views
ADD COMMENTlink modified 5 months ago by Biostar ♦♦ 20 • written 6.6 years ago by newDNASeqer670

can you please verify the command line and errors. It appears that the error comes from a different command. Your indices as specified are illumina_mouse_37_1 but the actual path in the error is usr/local/bowtie_indicies/mouse_ncbi_37_2

this suggests to me that the error results from a different command. The error would be the one reported if you tried to execute the fastq file directly, perhaps you have it marked as executable and you have a semicolon in the real command line

ADD REPLYlink modified 6.6 years ago • written 6.6 years ago by Istvan Albert ♦♦ 82k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1315 users visited in the last hour