Tophat Error: It Tries To Execute Lines In Fastq Files
0
0
Entering edit mode
8.2 years ago
newDNASeqer ▴ 730

From a previous RNASeq data that was analyzed a year ago, I tried to use the unmapped data and align it to a different species genome (mouse), and I used PiCard to convert the unmapped.bam file (generated by Tophat) to fastq format. Then I tried to run the following tophat command, but got the following error message:

> tophat -p 4 \
 --bowtie1 \
 -z 0 \
 --library-type fr-unstranded \
 --GTF illumina_mouse_37_1.gtf \
--read-mismatches   3 \
 --segment-mismatches 2 \
 --segment-length 25 \
 -o tophat_OUT \
 illumina_mouse_37_1 \
 fastq/file1.fastq.gz

-------------------------------------------------------------------------------
> [2013-07-30 13:06:28] Checking for Bowtie
          Bowtie version:     0.12.7.0
[2013-07-30 13:06:28] Checking for Samtools
        Samtools version:     0.1.18.0
[2013-07-30 13:06:28] Checking for Bowtie index files
[2013-07-30 13:06:28] Checking for reference FASTA file
[2013-07-30 13:06:28] Generating SAM header for /usr/local/bowtie_indicies/mouse_ncbi_37_2
Traceback (most recent call last):
  File "/usr/local/bin/tophat-2.0.6/tophat", line 4022, in <module>
    sys.exit(main())
  File "/usr/local/bin/tophat-2.0.6/tophat", line 3877, in main
    params.read_params = check_reads_format(params, reads_list)
  File "/usr/local/bin/tophat-2.0.6/tophat", line 1814, in check_reads_format
    zf = ZReader(f_name, params)
  File "/usr/local/bin/tophat-2.0.6/tophat", line 1767, in __init__
    self.file=open(filename)
IOError: [Errno 2] No such file or directory: ' '
./fastq/file1.fastq.gz: line 1: @HISEQ:64:C1VDJACXX:1:1101:1827:1944: command not found
./fastq/file1.fastq.gz: line 2: NGATCAAGTTGGATAGCAAGGGACCCGTCATTTACAAGCAAGAGCGCGTGACCCAGTACAACCGGCCGTTCAAGATTTGGAAGTTCCGTACTATGGTGAC: command not found
./fastq/file1.fastq.gz: line 3: +: command not found
./fastq/file1.fastq.gz: line 5: @HISEQ:64:C1VDJACXX:1:2215:2407:17672: command not found
./fastq/file1.fastq.gz: line 6: CTGAGATCTAAAGAGACATTTCCTCAATGCAAATCAGTTGATTCTTCAGCTCTTAGCTCCCTCCAGGTCCTAGGCCCAAACTTGGAAACTCCAAAGTCTA: command not found
./fastq/file1.fastq.gz: line 7: +: command not found
./fastq/file1.fastq.gz: line 8: syntax error near unexpected token `newline'
./fastq/file1.fastq.gz: line 8: `BBBFFFFFFFFFFIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIFIIIIIIIIIIIIIIIIIFFFIIIIIFIFFFFFFFFFFFFFFFFFBFBB<<'

why does tophat complain that those lines in fastq file are not commands? why does Tophat execute those lines in FastQ files? I don't understand, please help. thank you

tophat bowtie error • 3.2k views
ADD COMMENT
0
Entering edit mode

can you please verify the command line and errors. It appears that the error comes from a different command. Your indices as specified are illumina_mouse_37_1 but the actual path in the error is usr/local/bowtie_indicies/mouse_ncbi_37_2

this suggests to me that the error results from a different command. The error would be the one reported if you tried to execute the fastq file directly, perhaps you have it marked as executable and you have a semicolon in the real command line

ADD REPLY

Login before adding your answer.

Traffic: 1540 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6