Question: Sequence Blast Against Rfam Database
gravatar for liran0921
5.6 years ago by
liran0921100 wrote:

Hi All,

I am using blastn to blast my data against tRNAs which is extracted from RFam database. Then I picked one match from the blast result to confirm it by directly searching my read in RFam online (

Here is my read which have a 100% match with a tRNA: CCCATTCTTGCGACCCGGGTTCGATTCCCGGGCGGCGC


Clearly it's a perfect match (in bold). But when you search my query in RFam, there is no hit. However, the subject tRNA can be found in RFam.

Could anybody tell me what's the problem?

blast • 3.8k views
ADD COMMENTlink modified 5.6 years ago by Michael Dondrup45k • written 5.6 years ago by liran0921100

Could you paste the exact command you used for the BLAST? And the exact result line? Also, are you aware tha RFam provides a script for just this purpose? Here's the part of the code which is relevant:

$blastcmd = "blastall -p blastn -i $fafile -d $blastdb -e $blastcut -W7 -F F -b 1000000 -v 1000000 -m 8"; (By default $blastcut is 0.01)

ADD REPLYlink written 5.6 years ago by David Westergaard1.4k

Hi David, I will try the script you mentioned. my blast command is : blastn -query mapped_reads.fa -task megablast -db tRNA_for_blast -out mapped_vs_tRNA.txt -outfmt "6 qseqid sseqid qlen evalue pident nident mismatch qcovs qcovhsp" .

The matched record is: 10002-681 2341-1 38 2e-15 100.00 38 0 100 100

The blantn result shows that it indeed is a perfect match. I am just wondering why this query read can not be found in RFam database. Is it too short?

ADD REPLYlink written 5.6 years ago by liran0921100

I just skimmed through the script and the associated notes which I forgot to link to. Sorry!

It seem that blastn is just an initial step when querying the RFam database to narrow down the search. In the README, try jumping to the section (3) General comments on what is doing. It seems that RFam does an additional step of matching the covariate models cmsearch (The run_multi_infernal_search() subroutine from the perl script.)

ADD REPLYlink written 5.6 years ago by David Westergaard1.4k

Thanks. It should be better using . But I suppose that if a read is 100% match with a rRNA, then it should be from tRNA regardless of matching with CM model. I still want to know why my read can not be found by RFam online search.

ADD REPLYlink written 5.6 years ago by liran0921100

Have you tried contacting the lovely Rfam folks with this question? (

ADD REPLYlink written 5.6 years ago by sarahhunter600

Thanks for your advice. i really should try to contact them.

ADD REPLYlink written 5.6 years ago by liran0921100
gravatar for Michael Dondrup
5.6 years ago by
Bergen, Norway
Michael Dondrup45k wrote:

I think that it is because your tRNA sequence is truncated by having short reads. Covariance models use (among other things) information about the internal base-pairing of the RNA, in this case the cloverleaf structure.

tRNA from Wikimedia commons

(By Yikrazuul (Own work) CC-BY-SA-3.0, via Wikimedia Commons)

If you imagine an extreme case, where your tRNA fragment is exactly divided in half (this is almost the case for your example!), or you by change get only a large part of the variable loop, then you see that you loose a large portion of the most significant base pairing (acceptor stem, anticodon loop+ stem). That will possibly drop the score immediately, because the structure left would be a single hairpin loop, which are quite frequent and not significant for a tRNA. That means that for truncated sequences, blast might be more sensitive than RFam or tRNAscan-SE.

ADD COMMENTlink modified 5.6 years ago • written 5.6 years ago by Michael Dondrup45k

You are right. My data is from miRNA sequencing, so the reads will all be short. In this way, as you suggested, blast should perform better than tRNA-scan or rfam_scan to find the tRNA sequences.

ADD REPLYlink written 5.6 years ago by liran0921100
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 889 users visited in the last hour