Hello, I'm trying to do a meta-analysis of separate microarray studies conducted on different platforms. So I need all platforms' probes to map to common gene IDs. Problem is, for some of the studies, none of the GEO annotation files contain any identifier that identifier-conversion tools recognize. None of the tools on Gene Id Conversion Tool have been able to recognize or convert any of these columns.
This is the format of GEO's SOFT files, with no commonly recognized identifiers:
> hCP000001 NM_001101.2 GATTGCACATTGTTGTTTTTTTAATAGTCATTCCAAATATGAGATGCATTGTTACAGGAAGTCCCTTGCC chr7_-_5340026_5343473 gi|5016088|ref|NM_001101.2||gi|5016088|ref|NM_001101.2||+|1193|1793_228 actin,
> beta
>
> hCP000286 NM_012423.2 CGGACTCCTGGTCTGAGCCCAATAAAGACTGTTAATTCCTCATGCGTTGCCTGCCCTTCCTCCATTGTTG chr19_+_54682675_54687374 gi|14591905|ref|NM_012423.2||gi|14591905|ref|NM_012423.2||+|542|1142_77 ribosomal
> protein L13a
Does anyone know of a conversion tool for any of the above identifiers, or how to get gene-symbol probe annotations from GEO?
Thanks very much in advance!
There are at least 2 "commonly recognized identifiers" there; RefSeq mRNA and Entrez UID (GI). You can easily map the former to other gene IDs using e.g. BioMart.