Question: Query Ucsc With Known Sequence To Get Chr Position
gravatar for mathew.nightingale
5.3 years ago by
mathew.nightingale10 wrote:

Is it possible to query UCSC using mysql to ask what the resulting amplicon would be, sequence, seq length, chr start & stop positions, GC content etc. Similar to what you get when you manually use the In-Silico PCR function on the website.

Ideally I want to supply a file like this (these are dummy sequences)

tcctaacactggccggctcaatggag F1 accaaccagataacaggaag R1 tccacctctgatctgcaaagtgg F2 gctgactttaaaatctgacacca R2

And get an output with all the data.


ucsc mysql blat • 1.4k views
ADD COMMENTlink modified 2.5 years ago by Biostar ♦♦ 20 • written 5.3 years ago by mathew.nightingale10

I was able to something similar using gfPcr utility available downloaded from UCSC website.

gfPcr  17779 /gbdb/hg19  CCCATGAGTGGCTCCTAAAGCAGCTGC  TtACAGATTGATGATGCATGAAATGGGgggtggccaggggtggggggtga output

The output files contains this -

chr22:34304505-34304954 450bp CCCATGAGTGGCTCCTAAAGCAGCTGC TTACAGATTGATGATGCATGAAATGGGGGGTGGCCAGGGGTGGGGGGTGA CtCATGAGTGGCTCCTAAAGCAGCTGCgtggagctgagagcaaagtgctt ggagctctgacatctgggttctggattcaccttaaaagtgaagccaattt ctttgcttcctgtgacggctggtgtttctctgtctgaggaggagcttgct ttgagattacggtacacacttttcagcattgtggggtaagccattctgga taacagaatttctcaaataggataatccaatcccttacagacagcaagtc tttatttttaatctttaaggaatgagggtttctctaggatgttctgtgta cttaccctcactggctcaccatcagcccctggaaaacttcagctgtcata ttgggacgcacaaagcttgttatgaaccagccctgcctttctctgcagtc TCACCCCCCACCCCTGGCCACCCCCCATTTCATGCATCATCAATCTGTAA

ADD REPLYlink written 2.5 years ago by microfuge1.0k
gravatar for Pierre Lindenbaum
5.3 years ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum117k wrote:

no, mysql is 'just' a database engine and there is no way(*) to execute a system call from mysql.

Run an EPCR using a standalone program ( like NCBI EPCR ) and download the amplicon using, e.g. a DAS server How to get the sequence of a genomic region from UCSC?

(*): well , it could be possible with a mysql UDF but the ucsc wouldn't allow it.

ADD COMMENTlink written 5.3 years ago by Pierre Lindenbaum117k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1152 users visited in the last hour