Question: Error In Using Viralfusionseq With The Test Data On Centos 5 System
0
gravatar for akhattri
5.3 years ago by
akhattri0
akhattri0 wrote:

hi there, I am also getting this error while running VFS (http://sourceforge.net/projects/viralfusionseq/) (VERSION: Revision 1250) on CentOS 5 release 5.10 (Final) system. After this error SSAKE also fails. Please let me know how this can be fixed. The portions of error output are below. Thanks for the help.

Error 1

    Hashing CL7R_1_VFS.dynamic.min35.fq.gz
    Hashing CL7R_2_VFS.dynamic.min35.fq.gz
    Use of uninitialized value in concatenation (.) or string at
        /data3/users/arun/Apps/vfs/include/RPmethod.pm line 268 (#1)
        (W uninitialized) An undefined value was used as if it were already
        defined.  It was interpreted as a "" or a 0, but maybe it was a mistake.
        To suppress this warning assign a defined value to your variables.

        To help you figure out what was undefined, perl tells you what operation
        you used the undefined value in.  Note, however, that perl optimizes your
        program and the operation displayed in the warning may not necessarily
        appear literally in your program.  For example, "that $foo" is
        usually optimized into "that " . $foo, and the warning will refer to
        the concatenation (.) operator, even though there is no . in your
        program.

    Hashing vfs_dev.HKCI5a.4h_map.fq
    Entering Essential::tx_targeted_assembly.
    Skipped Insert Size estimation. Supplied insert size: 350
    Essential::ssake_reads_prep
    Assuming fasta file
    Hashing vfs_dev.HKCI5a.RPm.out_2.fa
    Processing vfs_dev.HKCI5a.RPm.out_1.fa and vfs_dev.HKCI5a.RPm.out_2.fa
    Use of uninitialized value in pattern match (m//) at
        /data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 2 (#1)
    Use of uninitialized value in concatenation (.) or string at
        /data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 2 (#1)
    Use of uninitialized value in pattern match (m//) at
        /data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 4 (#1)
    Use of uninitialized value in concatenation (.) or string at
        /data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 4 (#1)

--------------continued to even no of lines (6,8,10,12,14.....)--------------

        /data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 38 (#1)
    Use of uninitialized value in concatenation (.) or string at
        /data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 38 (#1)

Error 2: SSAKE

Running: /data3/users/arun/Apps/ssake_v3-8/SSAKE [v3.8]
-f vfs_dev.HKCI5a.RPm.plus.vicinity.CS_FnR.ssake.in
-s vfs_dev.HKCI5a.CSm.out.fullread.fa
    -i 0
-h 0
-w 1
-m 20
-o 3
-r 0.9
-t 0
-z 100
-p 1
-e 0.75
-k 4
-a 0.5
-x 20
Unpaired reads (optional) -g no-g
Scaffolds: vfs_dev.HKCI5a.targeted.assembly.sensitive.scaffolds
Merged contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.mergedcontigs
Pairing issues: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_issues
Pairing distance distribution: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_distribution.csv

Contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.contigs
Singlets: vfs_dev.HKCI5a.targeted.assembly.sensitive.singlets

Excluded reads: vfs_dev.HKCI5a.targeted.assembly.sensitive.short
Log: vfs_dev.HKCI5a.targeted.assembly.sensitive.log

=>Reading sequences initiated Thu Jan  2 14:45:44 CST 2014
Sequence reads loaded:
616Input error at line #618: The sequence "0:" is not in the right format for paired-end reads  -- Fatal
Make sure your input is in the form (input sequences can be of variable lengths):

>test
GCTACGACTATGACATACAGT:GTAGATTGATCGCATGCACGCT

Where : separates paired reads.  Spaces, <<.>> or any characters other than A,C,G or T in your input file might have caused this error, including reads with Ns.
mv: cannot stat `vfs_dev.HKCI5a_temp/*.targeted.*.contigs': No such file or directory
Number of log files deleted:  0
• 2.2k views
ADD COMMENTlink modified 28 days ago by Biostar ♦♦ 20 • written 5.3 years ago by akhattri0
0
gravatar for Marco Li
5.3 years ago by
Marco Li0
Marco Li0 wrote:

Hi akhattri, I suppose there was some problem in processing the gzipped fastq files (that subsequently lead to the problem you see), I should have fixed the problem.

Would you mind downloading the latest version again?

https://sourceforge.net/projects/viralfusionseq/files/release/vfs-2014-01-06-r1288.tar.gz/download

Thanks.

Marco

ADD COMMENTlink written 5.3 years ago by Marco Li0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1123 users visited in the last hour