Question: Primer3 Output File Format
0
gravatar for User 4055
7.7 years ago by
User 40550
User 40550 wrote:

Hi all,

I get two output files from running primer3 with my settings, a forward and reverse primer file. The first 10 or so lines of the forward file look like this:

    ACCEPTABLE LEFT PRIMERS
                                  0-based     #               self  self  qual-
   # sequence                       start ln  N   GC%     Tm   any   end   lity
   0 CAAAGCTTGCTCTTTGATCG              80 20  0 45.00 58.796  6.00  2.00  1.204
   1 CAAAGCTTGCTCTTTGATCGT             80 21  0 42.86 59.646  6.00  0.00  1.354
   2 GAGGATCAGTGAGGGACGGT              44 20  0 60.00 61.480  5.00  3.00  1.480
   3 AGGATCAGTGAGGGACGGT               45 19  0 57.89 59.498  5.00  3.00  1.502
   4 AGAGGATCAGTGAGGGACGG              43 20  0 60.00 61.608  5.00  1.00  1.608
   5 GAGGATCAGTGAGGGACGG               44 19  0 63.16 60.627  5.00  1.00  1.627
   6 TCAAAGCTTGCTCTTTGATCG             79 21  0 42.86 60.643  6.00  2.00  1.643
   7 TTTCGTCAAAGCTTGCTCTTT             74 21  0 38.10 59.280  6.00  2.00  1.720
   8 GACTTTCGTCAAAGCTTGCTC             71 21  0 47.62 59.256  6.00  2.00  1.744
   9 GCAAAAGACTTTCGTCAAAGC             65 21  0 42.86 59.148  7.00  3.00  1.852
  10 GGCAAAAGACTTTCGTCAAA              64 20  0 40.00 57.999  7.00  3.00  2.001

Can anyone tell me what the last three columns mean? I can't seem to find documentation on them anywhere! I assume that self-any and self-end refer to the likelihood of the sequence to hybridize to itself or just its 3'-end... however, do higher numbers mean more likely to hybridize, or less likely to hybridize? Also, is the quality value lower when the sequence is of better quality? If not, then why is the lowest quality value sequence at the top? I am really confused. If someone could help me out, I would most appreciate it. Thanks!

  • Nik.
primer pcr • 4.8k views
ADD COMMENTlink written 7.7 years ago by User 40550
5
gravatar for Neilfws
7.7 years ago by
Neilfws48k
Sydney, Australia
Neilfws48k wrote:

When you downloaded primer3, you should have found a file named "primer3_manual.htm". This is the required documentation, in which all 3 columns are explained. There's a copy here and at other places on the Web.

Briefly:

  • self_any is an alignment score describing the tendency of the primer to bind to itself
  • self_end is an alignment score derived by aligning primer 3' end with an identical primer
  • quality is the value of the so-called "objective function", by which primer pairs are sorted

In the first 2 cases a higher number = more self-alignment. In the last case, a lower number indicates a better primer pair.

ADD COMMENTlink written 7.7 years ago by Neilfws48k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1387 users visited in the last hour