What Does "One Base Removed To Allow Translational Frameshift" Mean In A Sequence Description?
1
1
Entering edit mode
10.5 years ago
chenxiaoyu4 ▴ 10
>YBL005W-B YBL005W-B SGDID:S000002147, Chr II from 221330-222634,222636-226598, **one base removed to allow translational frameshift**, transposable_element_gene, "Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated as one unit; polyprotein is processed to make a nucleocapsid-like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes"
ATGGAATCCCAACAATTATCTCAACATTCCCCGATTTTTCATGGTAGCGCCTGTGCTTCG........TTAACAAACAAATGGATTCATTAG

The fasta annotation shows as above. I used to think that the fasta sequence will have one base removed when compared with the chromosome. But then I find the fasta sequence is exactly same as the chromosome and nothing removed. Now I don't know what does it mean. Hope you can help me. Thanks~

fasta annotation • 2.8k views
ADD COMMENT
1
Entering edit mode

The annotation says 221330-222634,222636-226598 what is at position 222635 in your genome?

ADD REPLY
0
Entering edit mode

ACCTTCACCTTAGGCCAGGAACT It is an A in position 222635.

ADD REPLY
2
Entering edit mode
10.5 years ago
Zhaorong ★ 1.4k

I think "one base removed" refers to when the gene is translated into protein, not the nucleotide sequence itself. You can see the sequence of this gene in NCBI sequence viewer, here.

Note the "A" highlighted in green in the second line, that is the "base removed to allow translational frameshift".

ADD COMMENT
0
Entering edit mode

Now I see. The removed base is the 222635. But, can this gene be translated successfully? I mean, the base 222635 has caused a frameshift mutation and this fasta just wants to note there was a gene here. Or, this base will be removed by the organism during transcription or translation.

ADD REPLY

Login before adding your answer.

Traffic: 2654 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6