Deleted:Htseq-Count Not Giving Counts For Mirna Alignment To Mirbase

Question

[bio]

Hi,

I was trying to get the counts of miRNAs using htseq-count. The sam file is generated from adapter trimmed miRNA-seq alignment (bowtie) against miRBase mature miRNAs.

The sam file look like this:

HISEQ2000:383:C2452ACXX:1:2316:21334:99296    0    hsa-miR-30c-5p    1    255    23M    *    0    0    TGTAAACATCCTACACTCTCAGC    @@@DDDD>FFHFBH<C:FB9EE:    XA:i:0    MD:Z:23    NM:i:0
HISEQ2000:383:C2452ACXX:1:2316:21266:99322    0    hsa-miR-486-5p    1    255    22M    *    0    0    TCCTGTACTGAGCTGCCCCGAG    @C@FFFDFFHAHHIIIIIIEED    XA:i:0    MD:Z:22    NM:i:0

The reference fasta file used to create bowtie index:

>hsa-let-7a-5p
TGAGGTAGTAGGTTGTATAGTT
>hsa-let-7a-3p
CTATACAATCTACTGTCTTTC

Gtf file used :

hsa-mir-6859-1    .    miRNA_primary_transcript    17369    17436    .    -    .    ID "MI0022705"; Alias "MI0022705"; Name "hsa-mir-6859-1"
hsa-miR-6859-5p    .    miRNA    17409    17431    .    -    .    ID "MIMAT0027618"; Alias "MIMAT0027618"; Name "hsa-miR-6859-5p"; Derives_from "MI0022705"

I am not getting any counts for miRNAs based on these files with htseq-count. At the same time, I can see from the sam file that there are mappings to miRNAs.
htseq command used:

htseq-count --mode=intersection-strict --stranded=no --type=miRNA --idattr=Name  eg.sam  hsa.gff3

Could anyone advise me whether there is anything wrong in this approach or in the files I have used to get the counts ?

Thanks