How to create a dummy GFF file from fasta?
1
0
Entering edit mode
7 months ago
O.rka ▴ 390

I want to identify if the 3' region of genes have higher coverage in some samples compared to others. The way I thought of doing this was to map to the genes and then convert to bed to calculate the coverage for specific regions via bedtools coverage.

bedtools coverage [OPTIONS] -a <bed/gff/vcf> -b <bed/gff/vcf> so I need to get a gff file. Is there a tool or easy method that I can use to create a dummy GFF so I can run this tool? If there is a better method to do this please let me know.

My fasta file looks like this:

>EG11277
ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGA
>EG10998
ATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCCGCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCAGGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAACGGTTCCGACTACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATTGTTGCGAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGTCAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTACCAGGAAGCGATGGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCCCCATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCTCAAGCACCAGGTACGCTCATTGGTGCCAGCCGTGATGAAGACGAATTACCGGTCAAGGGCATTTCCAATCTGAATAACATGGCAATGTTCAGCGTTTCTGGTCCGGGGATGAAAGGGATGGTCGGCATGGCGGCGCGCGTCTTTGCAGCGATGTCACGCGCCCGTATTTCCGTGGTGCTGATTACGCAATCATCTTCCGAATACAGCATCAGTTTCTGCGTTCCACAAAGCGACTGTGTGCGAGCTGAACGGGCAATGCAGGAAGAGTTCTACCTGGAACTGAAAGAAGGCTTACTGGAGCCGCTGGCAGTGACGGAACGGCTGGCCATTATCTCGGTGGTAGGTGATGGTATGCGCACCTTGCGTGGGATCTCGGCGAAATTCTTTGCCGCACTGGCCCGCGCCAATATCAACATTGTCGCCATTGCTCAGGGATCTTCTGAACGCTCAATCTCTGTCGTGGTAAATAACGATGATGCGACCACTGGCGTGCGCGTTACTCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTGGCGTCGGTGGCGTTGGCGGTGCGCTGCTGGAGCAACTGAAGCGTCAGCAAAGCTGGCTGAAGAATAAACATATCGACTTACGTGTCTGCGGTGTTGCCAACTCGAAGGCTCTGCTCACCAATGTACATGGCCTTAATCTGGAAAACTGGCAGGAAGAACTGGCGCAAGCCAAAGAGCCGTTTAATCTCGGGCGCTTAATTCGCCTCGTGAAAGAATATCATCTGCTGAACCCGGTCATTGTTGACTGCACTTCCAGCCAGGCAGTGGCGGATCAATATGCCGACTTCCTGCGCGAAGGTTTCCACGTTGTCACGCCGAACAAAAAGGCCAACACCTCGTCGATGGATTACTACCATCAGTTGCGTTATGCGGCGGAAAAATCGCGGCGTAAATTCCTCTATGACACCAACGTTGGGGCTGGATTACCGGTTATTGAGAACCTGCAAAATCTGCTCAATGCAGGTGATGAATTGATGAAGTTCTCCGGCATTCTTTCTGGTTCGCTTTCTTATATCTTCGGCAAGTTAGACGAAGGCATGAGTTTCTCCGAGGCGACCACGCTGGCGCGGGAAATGGGTTATACCGAACCGGACCCGCGAGATGATCTTTCTGGTATGGATGTGGCGCGTAAACTATTGATTCTCGCTCGTGAAACGGGACGTGAACTGGAGCTGGCGGATATTGAAATTGAACCTGTGCTGCCCGCAGAGTTTAACGCCGAGGGTGATGTTGCCGCTTTTATGGCGAATCTGTCACAACTCGACGATCTCTTTGCCGCGCGCGTGGCGAAGGCCCGTGATGAAGGAAAAGTTTTGCGCTATGTTGGCAATATTGATGAAGATGGCGTCTGCCGCGTGAAGATTGCCGAAGTGGATGGTAATGATCCGCTGTTCAAAGTGAAAAATGGCGAAAACGCCCTGGCCTTCTATAGCCACTATTATCAGCCGCTGCCGTTGGTACTGCGCGGATATGGTGCGGGCAATGACGTTACAGCTGCCGGTGTCTTTGCTGATCTGCTACGTACCCTCTCATGGAAGTTAGGAGTCTGA
>EG10999
ATGGTTAAAGTTTATGCCCCGGCTTCCAGTGCCAATATGAGCGTCGGGTTTGATGTGCTCGGGGCGGCGGTGACACCTGTTGATGGTGCATTGCTCGGAGATGTAGTCACGGTTGAGGCGGCAGAGACATTCAGTCTCAACAACCTCGGACGCTTTGCCGATAAGCTGCCGTCAGAACCACGGGAAAATATCGTTTATCAGTGCTGGGAGCGTTTTTGCCAGGAACTGGGTAAGCAAATTCCAGTGGCGATGACCCTGGAAAAGAATATGCCGATCGGTTCGGGCTTAGGCTCCAGTGCCTGTTCGGTGGTCGCGGCGCTGATGGCGATGAATGAACACTGCGGCAAGCCGCTTAATGACACTCGTTTGCTGGCTTTGATGGGCGAGCTGGAAGGCCGTATCTCCGGCAGCATTCATTACGACAACGTGGCACCGTGTTTTCTCGGTGGTATGCAGTTGATGATCGAAGAAAACGACATCATCAGCCAGCAAGTGCCAGGGTTTGATGAGTGGCTGTGGGTGCTGGCGTATCCGGGGATTAAAGTCTCGACGGCAGAAGCCAGGGCTATTTTACCGGCGCAGTATCGCCGCCAGGATTGCATTGCGCACGGGCGACATCTGGCAGGCTTCATTCACGCCTGCTATTCCCGTCAGCCTGAGCTTGCCGCGAAGCTGATGAAAGATGTTATCGCTGAACCCTACCGTGAACGGTTACTGCCAGGCTTCCGGCAGGCGCGGCAGGCGGTCGCGGAAATCGGCGCGGTAGCGAGCGGTATCTCCGGCTCCGGCCCGACCTTGTTCGCTCTGTGTGACAAGCCGGAAACCGCCCAGCGCGTTGCCGACTGGTTGGGTAAGAACTACCTGCAAAATCAGGAAGGTTTTGTTCATATTTGCCGGCTGGATACGGCGGGCGCACGAGTACTGGAAAACTAA
fasta coverage bed gff • 350 views
ADD COMMENT
0
Entering edit mode
7 months ago
O.rka ▴ 390

I ended up doing this and it worked with bedtools.

read_fasta is a simple function I wrote in soothsayer_utils. It's basically a wrapper around BioPython's SimpleFastaParser with some added versatility.

Anyways, here's the quick'n'dirty:

import soothsayer_utils as syu
genome_version="Genbank-U00096.2_EcoCyc-v21.1"
f = open("eco.genes.fna.gff", "w")
for id, seq in syu.read_fasta("eco.genes.fna").items():
    print(id, genome_version, "gene", 1, len(seq), ".", "+", 0, 'gene_id={};gene_name={}'.format(id, id), sep="\t", file=f)
f.close()
ADD COMMENT

Login before adding your answer.

Traffic: 1963 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6