Query on miRDeep2
0
0
Entering edit mode
18 days ago

Actually was working with miRDeep2, and the error was

The mapped reference id CM000663.2 from file

ZNT16areads_vs_genome.arf

is not an id of the genome file

GCA_000001405.15_GRCh38_genomic.fa

my ZNT16areads_vs_genome.arf file format is

seq_6028_x1375  22  1   22  tccttcattccaccggagtctg  CM000663.2  22  209432166   209432187   tccttcattccaccggagtctg  +   0   mmmmmmmmmmmmmmmmmmmmmm
seq_7403_x1189  22  1   22  aaaccgttaccattactgagtt  CM000679.2  22  28861403    28861424    aaaccgttaccattactgagtt  -   0   mmmmmmmmmmmmmmmmmmmmmm
seq_8592_x1144  22  1   22  tgaggtagtaggttgtatagtt  CM000671.2  22  94175962    94175983    tgaggtagtaggttgtatagtt  +   0   mmmmmmmmmmmmmmmmmmmmmm
seq_8592_x1144  22  1   22  tgaggtagtaggttgtatagtt  CM000684.2  22  46112752    46112773    tgaggtagtaggttgtatagtt  +   0   mmmmmmmmmmmmmmmmmmmmmm
seq_8592_x1144  22  1   22  tgaggtagtaggttgtatagtt  CM000673.2  22  122146568   122146589   tgaggtagtaggttgtatagtt  -   0   mmmmmmmmmmmmmmmmmmmmmm

while my Genome format is

>CM000663.2_Homo_sapiens_chromosome_1,_GRCh38_reference_primary_assembly

It would be helpful if anybody can revert back with my query

mirDeep2 mapper • 89 views
ADD COMMENT

Login before adding your answer.

Traffic: 1736 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6